\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207710323:

Variant ID: vg1207710323 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7710323
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGCTGGATTGGCGCGAGGCGCGTCCGGTGGAGGAGGCCGGCTTGGTGCGAGAGGCGCGACTGGCGGTGGAGGAGGCGTCCTCGGTGCGAGGAGGAGCT[G/A]
CCGGTGGATGTGGCGTAGTCTTCGGCGCACGAAGGCTGGCCGGCTGGGGGCGCCGGTACAGTGGTCCCACTTGGCGGCTGAGGTTGAGTGGTGGTGGAGC

Reverse complement sequence

GCTCCACCACCACTCAACCTCAGCCGCCAAGTGGGACCACTGTACCGGCGCCCCCAGCCGGCCAGCCTTCGTGCGCCGAAGACTACGCCACATCCACCGG[C/T]
AGCTCCTCCTCGCACCGAGGACGCCTCCTCCACCGCCAGTCGCGCCTCTCGCACCAAGCCGGCCTCCTCCACCGGACGCGCCTCGCGCCAATCCAGCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 9.30% 5.97% 33.52% NA
All Indica  2759 20.10% 15.80% 9.28% 54.87% NA
All Japonica  1512 95.70% 0.10% 0.73% 3.44% NA
Aus  269 95.90% 0.00% 2.97% 1.12% NA
Indica I  595 27.20% 22.00% 3.19% 47.56% NA
Indica II  465 12.70% 1.90% 7.53% 77.85% NA
Indica III  913 16.30% 16.80% 13.25% 53.67% NA
Indica Intermediate  786 23.40% 18.10% 10.31% 48.22% NA
Temperate Japonica  767 94.70% 0.30% 0.65% 4.43% NA
Tropical Japonica  504 95.80% 0.00% 0.99% 3.17% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 76.70% 4.40% 2.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207710323 G -> DEL N N silent_mutation Average:81.046; most accessible tissue: Zhenshan97 young leaf, score: 89.112 N N N N
vg1207710323 G -> A LOC_Os12g13674.1 3_prime_UTR_variant ; 635.0bp to feature; MODIFIER silent_mutation Average:81.046; most accessible tissue: Zhenshan97 young leaf, score: 89.112 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207710323 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207710323 NA 1.24E-08 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207710323 NA 2.35E-07 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207710323 NA 1.02E-06 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207710323 NA 1.11E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207710323 NA 4.77E-09 mr1888 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251