Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207672832:

Variant ID: vg1207672832 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7672832
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

CAAATTTTAGAATTATTTTTTTGGACTTTGGAACCCAAGAATTTTCTTGCGCAAACTAGAATGAGAGAGAAAGTGAAGCAGGGAGAGAGTGAGTAGACCA[G/A]
TCTTAATGAGATAAGAATAATGCATCAATAGAGGATGATAGGAGTCGTATTGAGTCTAGCTAGACCTTGCTTTATTGTCGCCATAGGGCATATGGAGTAG

Reverse complement sequence

CTACTCCATATGCCCTATGGCGACAATAAAGCAAGGTCTAGCTAGACTCAATACGACTCCTATCATCCTCTATTGATGCATTATTCTTATCTCATTAAGA[C/T]
TGGTCTACTCACTCTCTCCCTGCTTCACTTTCTCTCTCATTCTAGTTTGCGCAAGAAAATTCTTGGGTTCCAAAGTCCAAAAAAATAATTCTAAAATTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	9.20%	1.08%	1.14%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.00%	NA
All Japonica	1512	66.50%	26.80%	3.17%	3.57%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	72.00%	26.50%	1.43%	0.13%	NA
Tropical Japonica	504	69.00%	15.30%	6.75%	8.93%	NA
Japonica Intermediate	241	43.60%	51.90%	1.24%	3.32%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207672832	G -> DEL	N	N	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg1207672832	G -> A	LOC_Os12g13650.1	upstream_gene_variant ; 2566.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg1207672832	G -> A	LOC_Os12g13640.1	downstream_gene_variant ; 3239.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg1207672832	G -> A	LOC_Os12g13640-LOC_Os12g13650	intergenic_region ; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207672832	NA	3.57E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207672832	NA	4.40E-08	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	9.20E-08	mr1149_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	2.71E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	9.37E-06	mr1318_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	2.67E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	5.79E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	3.11E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	4.20E-07	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	7.09E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	9.23E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	3.23E-06	mr1728_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	7.86E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	1.40E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	3.75E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	8.69E-06	mr1974_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832	NA	7.56E-07	mr1986_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251