\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207672832:

Variant ID: vg1207672832 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7672832
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CAAATTTTAGAATTATTTTTTTGGACTTTGGAACCCAAGAATTTTCTTGCGCAAACTAGAATGAGAGAGAAAGTGAAGCAGGGAGAGAGTGAGTAGACCA[G/A]
TCTTAATGAGATAAGAATAATGCATCAATAGAGGATGATAGGAGTCGTATTGAGTCTAGCTAGACCTTGCTTTATTGTCGCCATAGGGCATATGGAGTAG

Reverse complement sequence

CTACTCCATATGCCCTATGGCGACAATAAAGCAAGGTCTAGCTAGACTCAATACGACTCCTATCATCCTCTATTGATGCATTATTCTTATCTCATTAAGA[C/T]
TGGTCTACTCACTCTCTCCCTGCTTCACTTTCTCTCTCATTCTAGTTTGCGCAAGAAAATTCTTGGGTTCCAAAGTCCAAAAAAATAATTCTAAAATTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 9.20% 1.08% 1.14% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 66.50% 26.80% 3.17% 3.57% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 72.00% 26.50% 1.43% 0.13% NA
Tropical Japonica  504 69.00% 15.30% 6.75% 8.93% NA
Japonica Intermediate  241 43.60% 51.90% 1.24% 3.32% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207672832 G -> DEL N N silent_mutation Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg1207672832 G -> A LOC_Os12g13650.1 upstream_gene_variant ; 2566.0bp to feature; MODIFIER silent_mutation Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg1207672832 G -> A LOC_Os12g13640.1 downstream_gene_variant ; 3239.0bp to feature; MODIFIER silent_mutation Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg1207672832 G -> A LOC_Os12g13640-LOC_Os12g13650 intergenic_region ; MODIFIER silent_mutation Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207672832 NA 3.57E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207672832 NA 4.40E-08 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 9.20E-08 mr1149_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 2.71E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 9.37E-06 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 2.67E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 5.79E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 3.11E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 4.20E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 7.09E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 9.23E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 3.23E-06 mr1728_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 7.86E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 1.40E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 3.75E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 8.69E-06 mr1974_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207672832 NA 7.56E-07 mr1986_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251