| Variant ID: vg1207672832 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7672832 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )
CAAATTTTAGAATTATTTTTTTGGACTTTGGAACCCAAGAATTTTCTTGCGCAAACTAGAATGAGAGAGAAAGTGAAGCAGGGAGAGAGTGAGTAGACCA[G/A]
TCTTAATGAGATAAGAATAATGCATCAATAGAGGATGATAGGAGTCGTATTGAGTCTAGCTAGACCTTGCTTTATTGTCGCCATAGGGCATATGGAGTAG
CTACTCCATATGCCCTATGGCGACAATAAAGCAAGGTCTAGCTAGACTCAATACGACTCCTATCATCCTCTATTGATGCATTATTCTTATCTCATTAAGA[C/T]
TGGTCTACTCACTCTCTCCCTGCTTCACTTTCTCTCTCATTCTAGTTTGCGCAAGAAAATTCTTGGGTTCCAAAGTCCAAAAAAATAATTCTAAAATTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.60% | 9.20% | 1.08% | 1.14% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 66.50% | 26.80% | 3.17% | 3.57% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 72.00% | 26.50% | 1.43% | 0.13% | NA |
| Tropical Japonica | 504 | 69.00% | 15.30% | 6.75% | 8.93% | NA |
| Japonica Intermediate | 241 | 43.60% | 51.90% | 1.24% | 3.32% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207672832 | G -> DEL | N | N | silent_mutation | Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| vg1207672832 | G -> A | LOC_Os12g13650.1 | upstream_gene_variant ; 2566.0bp to feature; MODIFIER | silent_mutation | Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| vg1207672832 | G -> A | LOC_Os12g13640.1 | downstream_gene_variant ; 3239.0bp to feature; MODIFIER | silent_mutation | Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| vg1207672832 | G -> A | LOC_Os12g13640-LOC_Os12g13650 | intergenic_region ; MODIFIER | silent_mutation | Average:57.625; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207672832 | NA | 3.57E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1207672832 | NA | 4.40E-08 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207672832 | NA | 9.20E-08 | mr1149_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207672832 | NA | 2.71E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207672832 | NA | 9.37E-06 | mr1318_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207672832 | NA | 2.67E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207672832 | NA | 5.79E-07 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207672832 | NA | 3.11E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207672832 | NA | 4.20E-07 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207672832 | NA | 7.09E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/