\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207647527:

Variant ID: vg1207647527 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7647527
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCAGTCTGATTTTCGTTCCTTGATCACAAAACCGGGTACTACAGGTCCCCGAACTTATGAAACCGTTTAAATAAGGTCCCTTGGCAGTATTTGACTCCG[G/T]
TTTTGGGTGAGGTGGCGCCTACGTGACTAATTAACTCGGTCTTCATCTGACGTGGCATTGACGTGGCACTTACGTGGCAATTCGATCCGAAAAATAATAA

Reverse complement sequence

TTATTATTTTTCGGATCGAATTGCCACGTAAGTGCCACGTCAATGCCACGTCAGATGAAGACCGAGTTAATTAGTCACGTAGGCGCCACCTCACCCAAAA[C/A]
CGGAGTCAAATACTGCCAAGGGACCTTATTTAAACGGTTTCATAAGTTCGGGGACCTGTAGTACCCGGTTTTGTGATCAAGGAACGAAAATCAGACTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 4.70% 0.76% 3.05% NA
All Indica  2759 94.60% 0.20% 0.04% 5.15% NA
All Japonica  1512 84.20% 13.70% 2.12% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.40% 0.00% 0.00% 15.63% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 97.90% 0.10% 0.00% 1.97% NA
Indica Intermediate  786 95.50% 0.40% 0.13% 3.94% NA
Temperate Japonica  767 96.00% 2.00% 2.09% 0.00% NA
Tropical Japonica  504 62.90% 34.30% 2.78% 0.00% NA
Japonica Intermediate  241 91.30% 7.90% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 85.60% 10.00% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207647527 G -> DEL N N silent_mutation Average:85.724; most accessible tissue: Minghui63 panicle, score: 97.507 N N N N
vg1207647527 G -> T LOC_Os12g13590.1 upstream_gene_variant ; 3233.0bp to feature; MODIFIER silent_mutation Average:85.724; most accessible tissue: Minghui63 panicle, score: 97.507 N N N N
vg1207647527 G -> T LOC_Os12g13610.1 upstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:85.724; most accessible tissue: Minghui63 panicle, score: 97.507 N N N N
vg1207647527 G -> T LOC_Os12g13600.1 downstream_gene_variant ; 407.0bp to feature; MODIFIER silent_mutation Average:85.724; most accessible tissue: Minghui63 panicle, score: 97.507 N N N N
vg1207647527 G -> T LOC_Os12g13590-LOC_Os12g13600 intergenic_region ; MODIFIER silent_mutation Average:85.724; most accessible tissue: Minghui63 panicle, score: 97.507 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207647527 G T 0.02 0.01 0.01 0.02 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207647527 NA 3.34E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207647527 NA 1.69E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207647527 NA 7.30E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207647527 NA 3.95E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207647527 8.59E-06 NA mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207647527 NA 3.45E-09 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207647527 3.84E-09 NA mr1850_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207647527 NA 2.43E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251