\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207608413:

Variant ID: vg1207608413 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7608413
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GACGAGGCACGACCGCTCCTCTCAGTCAGCCGCTAGCGCCAACGCCTCTGCCGCCTCCACCTCCTCCACCGCTGGCCATGCCGACATCGATCGGCGTCAC[G/A]
GCATCACCTCCTTGACCAACCCATCTACCATGTCAAACGTTGCTACTTCCACCATGGACGCCGTGCCATCCACATGGGGAGTATGACGTCCCCGCCACCC

Reverse complement sequence

GGGTGGCGGGGACGTCATACTCCCCATGTGGATGGCACGGCGTCCATGGTGGAAGTAGCAACGTTTGACATGGTAGATGGGTTGGTCAAGGAGGTGATGC[C/T]
GTGACGCCGATCGATGTCGGCATGGCCAGCGGTGGAGGAGGTGGAGGCGGCAGAGGCGTTGGCGCTAGCGGCTGACTGAGAGGAGCGGTCGTGCCTCGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 15.40% 0.00% 0.00% NA
All Indica  2759 81.90% 18.10% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 41.30% 58.70% 0.00% 0.00% NA
Indica I  595 61.00% 39.00% 0.00% 0.00% NA
Indica II  465 92.70% 7.30% 0.00% 0.00% NA
Indica III  913 90.50% 9.50% 0.00% 0.00% NA
Indica Intermediate  786 81.40% 18.60% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207608413 G -> A LOC_Os12g13560.1 upstream_gene_variant ; 2436.0bp to feature; MODIFIER silent_mutation Average:68.65; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg1207608413 G -> A LOC_Os12g13550.1 downstream_gene_variant ; 1491.0bp to feature; MODIFIER silent_mutation Average:68.65; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg1207608413 G -> A LOC_Os12g13570.1 downstream_gene_variant ; 3888.0bp to feature; MODIFIER silent_mutation Average:68.65; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg1207608413 G -> A LOC_Os12g13550-LOC_Os12g13560 intergenic_region ; MODIFIER silent_mutation Average:68.65; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207608413 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207608413 NA 3.89E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207608413 NA 4.41E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 9.36E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 2.93E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 7.76E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 2.90E-12 mr1265_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 2.15E-07 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 3.50E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 1.98E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 2.92E-10 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 9.41E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 8.57E-12 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 1.19E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413 NA 3.27E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251