Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207608413:

Variant ID: vg1207608413 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7608413
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GACGAGGCACGACCGCTCCTCTCAGTCAGCCGCTAGCGCCAACGCCTCTGCCGCCTCCACCTCCTCCACCGCTGGCCATGCCGACATCGATCGGCGTCAC[G/A]
GCATCACCTCCTTGACCAACCCATCTACCATGTCAAACGTTGCTACTTCCACCATGGACGCCGTGCCATCCACATGGGGAGTATGACGTCCCCGCCACCC

Reverse complement sequence

GGGTGGCGGGGACGTCATACTCCCCATGTGGATGGCACGGCGTCCATGGTGGAAGTAGCAACGTTTGACATGGTAGATGGGTTGGTCAAGGAGGTGATGC[C/T]
GTGACGCCGATCGATGTCGGCATGGCCAGCGGTGGAGGAGGTGGAGGCGGCAGAGGCGTTGGCGCTAGCGGCTGACTGAGAGGAGCGGTCGTGCCTCGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	15.40%	0.00%	0.00%	NA
All Indica	2759	81.90%	18.10%	0.00%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	41.30%	58.70%	0.00%	0.00%	NA
Indica I	595	61.00%	39.00%	0.00%	0.00%	NA
Indica II	465	92.70%	7.30%	0.00%	0.00%	NA
Indica III	913	90.50%	9.50%	0.00%	0.00%	NA
Indica Intermediate	786	81.40%	18.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	44.80%	55.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207608413	G -> A	LOC_Os12g13560.1	upstream_gene_variant ; 2436.0bp to feature; MODIFIER	silent_mutation	Average:68.65; most accessible tissue: Zhenshan97 young leaf, score: 87.443	N	N	N	N
vg1207608413	G -> A	LOC_Os12g13550.1	downstream_gene_variant ; 1491.0bp to feature; MODIFIER	silent_mutation	Average:68.65; most accessible tissue: Zhenshan97 young leaf, score: 87.443	N	N	N	N
vg1207608413	G -> A	LOC_Os12g13570.1	downstream_gene_variant ; 3888.0bp to feature; MODIFIER	silent_mutation	Average:68.65; most accessible tissue: Zhenshan97 young leaf, score: 87.443	N	N	N	N
vg1207608413	G -> A	LOC_Os12g13550-LOC_Os12g13560	intergenic_region ; MODIFIER	silent_mutation	Average:68.65; most accessible tissue: Zhenshan97 young leaf, score: 87.443	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1207608413	G	A	-0.01	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207608413	NA	3.89E-17	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207608413	NA	4.41E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	9.36E-07	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	2.93E-06	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	7.76E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	2.90E-12	mr1265_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	2.15E-07	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	3.50E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	1.98E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	2.92E-10	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	9.41E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	8.57E-12	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	1.19E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207608413	NA	3.27E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251