\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207573922:

Variant ID: vg1207573922 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 7573922
Reference Allele: TAAlternative Allele: AA,T
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCGAAACAAAACGAAAGTAAAGGGTGGCGATGCGCCGAGATTGTATTGAACTTGTGTTGTTGTATTACATGGGGCTCGGGGTCTATTTATACCCGAGAT[TA/AA,T]
CAAAATATGTCCGTGTCGGACACGACTCTTATCTCTAACAAACTCTAATATACCATAAGTCTTTGCGGCAGACTTTTGCCCAAACATATCTATAAGGAAA

Reverse complement sequence

TTTCCTTATAGATATGTTTGGGCAAAAGTCTGCCGCAAAGACTTATGGTATATTAGAGTTTGTTAGAGATAAGAGTCGTGTCCGACACGGACATATTTTG[TA/TT,A]
ATCTCGGGTATAAATAGACCCCGAGCCCCATGTAATACAACAACACAAGTTCAATACAATCTCGGCGCATCGCCACCCTTTACTTTCGTTTTGTTTCGAC

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 5.20% 0.70% 0.42% NA
All Indica  2759 89.20% 8.90% 1.16% 0.72% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.40% 6.40% 0.34% 0.84% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 85.30% 11.00% 2.63% 1.10% NA
Indica Intermediate  786 85.60% 13.00% 0.76% 0.64% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207573922 TA -> DEL N N silent_mutation Average:36.592; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1207573922 TA -> AA LOC_Os12g13490.1 upstream_gene_variant ; 650.0bp to feature; MODIFIER silent_mutation Average:36.592; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1207573922 TA -> AA LOC_Os12g13480-LOC_Os12g13490 intergenic_region ; MODIFIER silent_mutation Average:36.592; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1207573922 TA -> T LOC_Os12g13490.1 upstream_gene_variant ; 649.0bp to feature; MODIFIER N Average:36.592; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1207573922 TA -> T LOC_Os12g13480-LOC_Os12g13490 intergenic_region ; MODIFIER N Average:36.592; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207573922 NA 1.50E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207573922 7.95E-07 7.95E-07 mr1497 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207573922 NA 2.26E-07 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251