\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207573581:

Variant ID: vg1207573581 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 7573581
Reference Allele: GTAlternative Allele: AT,G
Primary Allele: GTSecondary Allele: AT

Inferred Ancestral Allele : GT (evidence from allele frequency in Oryza rufipogon: GT: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCAACTGATGCAGCTATAATTATGAAAAAAAGGACAATATCTAGACAATCAAGCCGTTGGATGTTTCATAGAGTGGTGGATATCCTATATAATCTAA[GT/AT,G]
CAACGTTGGTATTTAACCTAATCGGCTGCCTTCTAGCAACAGATGTTAGCCGATTGAAGGTTAGATAACAATATTGCCTAAGATTATATAGAATATATGA

Reverse complement sequence

TCATATATTCTATATAATCTTAGGCAATATTGTTATCTAACCTTCAATCGGCTAACATCTGTTGCTAGAAGGCAGCCGATTAGGTTAAATACCAACGTTG[AC/AT,C]
TTAGATTATATAGGATATCCACCACTCTATGAAACATCCAACGGCTTGATTGTCTAGATATTGTCCTTTTTTTCATAATTATAGCTGCATCAGTTGAGTT

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 5.10% 0.32% 0.89% NA
All Indica  2759 89.20% 8.70% 0.54% 1.49% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.30% 5.90% 0.50% 1.34% NA
Indica II  465 98.90% 0.90% 0.00% 0.22% NA
Indica III  913 85.30% 11.50% 0.88% 2.30% NA
Indica Intermediate  786 85.80% 12.30% 0.51% 1.40% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207573581 GT -> DEL N N silent_mutation Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1207573581 GT -> AT LOC_Os12g13490.1 upstream_gene_variant ; 991.0bp to feature; MODIFIER silent_mutation Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1207573581 GT -> AT LOC_Os12g13480-LOC_Os12g13490 intergenic_region ; MODIFIER silent_mutation Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1207573581 GT -> G LOC_Os12g13490.1 upstream_gene_variant ; 990.0bp to feature; MODIFIER N Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1207573581 GT -> G LOC_Os12g13480-LOC_Os12g13490 intergenic_region ; MODIFIER N Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207573581 4.05E-06 1.07E-07 mr1509 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251