\
| Variant ID: vg1207573581 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 7573581 |
| Reference Allele: GT | Alternative Allele: AT,G |
| Primary Allele: GT | Secondary Allele: AT |
Inferred Ancestral Allele : GT (evidence from allele frequency in Oryza rufipogon: GT: 1.00, others allele: 0.00, population size: 286. )
AACTCAACTGATGCAGCTATAATTATGAAAAAAAGGACAATATCTAGACAATCAAGCCGTTGGATGTTTCATAGAGTGGTGGATATCCTATATAATCTAA[GT/AT,G]
CAACGTTGGTATTTAACCTAATCGGCTGCCTTCTAGCAACAGATGTTAGCCGATTGAAGGTTAGATAACAATATTGCCTAAGATTATATAGAATATATGA
TCATATATTCTATATAATCTTAGGCAATATTGTTATCTAACCTTCAATCGGCTAACATCTGTTGCTAGAAGGCAGCCGATTAGGTTAAATACCAACGTTG[AC/AT,C]
TTAGATTATATAGGATATCCACCACTCTATGAAACATCCAACGGCTTGATTGTCTAGATATTGTCCTTTTTTTCATAATTATAGCTGCATCAGTTGAGTT
| Populations | Population Size | Frequency of GT(primary allele) | Frequency of AT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 5.10% | 0.32% | 0.89% | NA |
| All Indica | 2759 | 89.20% | 8.70% | 0.54% | 1.49% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.30% | 5.90% | 0.50% | 1.34% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 85.30% | 11.50% | 0.88% | 2.30% | NA |
| Indica Intermediate | 786 | 85.80% | 12.30% | 0.51% | 1.40% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207573581 | GT -> DEL | N | N | silent_mutation | Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg1207573581 | GT -> AT | LOC_Os12g13490.1 | upstream_gene_variant ; 991.0bp to feature; MODIFIER | silent_mutation | Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg1207573581 | GT -> AT | LOC_Os12g13480-LOC_Os12g13490 | intergenic_region ; MODIFIER | silent_mutation | Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg1207573581 | GT -> G | LOC_Os12g13490.1 | upstream_gene_variant ; 990.0bp to feature; MODIFIER | N | Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg1207573581 | GT -> G | LOC_Os12g13480-LOC_Os12g13490 | intergenic_region ; MODIFIER | N | Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207573581 | 4.05E-06 | 1.07E-07 | mr1509 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |