\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207570300:

Variant ID: vg1207570300 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7570300
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CACTGCAAGAGCCATATGTGTTGTGTCATCAGTGATCTCATTTAGTGTTGGTGTTGAATCCATAGACCTGAGGTTATCATGGTTTCTAACATGTGTAGTA[A/G]
CTTACTCAGGGACTGCTAAACGCTACTCCGTAACTGGATAGTTATAAAAGTAGTTTTCGGGTATGCTATGAAACATGCAGTGGGATATGAATAATCAAGA

Reverse complement sequence

TCTTGATTATTCATATCCCACTGCATGTTTCATAGCATACCCGAAAACTACTTTTATAACTATCCAGTTACGGAGTAGCGTTTAGCAGTCCCTGAGTAAG[T/C]
TACTACACATGTTAGAAACCATGATAACCTCAGGTCTATGGATTCAACACCAACACTAAATGAGATCACTGATGACACAACACATATGGCTCTTGCAGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 28.50% 0.51% 2.98% NA
All Indica  2759 92.40% 2.20% 0.40% 5.04% NA
All Japonica  1512 18.60% 80.60% 0.79% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 82.00% 1.50% 1.34% 15.13% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 96.50% 1.30% 0.33% 1.86% NA
Indica Intermediate  786 93.10% 2.80% 0.00% 4.07% NA
Temperate Japonica  767 21.00% 77.60% 1.43% 0.00% NA
Tropical Japonica  504 8.50% 91.50% 0.00% 0.00% NA
Japonica Intermediate  241 32.00% 67.60% 0.41% 0.00% NA
VI/Aromatic  96 71.90% 27.10% 0.00% 1.04% NA
Intermediate  90 54.40% 43.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207570300 A -> DEL N N silent_mutation Average:50.178; most accessible tissue: Minghui63 flower, score: 62.973 N N N N
vg1207570300 A -> G LOC_Os12g13490.1 upstream_gene_variant ; 4272.0bp to feature; MODIFIER silent_mutation Average:50.178; most accessible tissue: Minghui63 flower, score: 62.973 N N N N
vg1207570300 A -> G LOC_Os12g13480.1 downstream_gene_variant ; 4035.0bp to feature; MODIFIER silent_mutation Average:50.178; most accessible tissue: Minghui63 flower, score: 62.973 N N N N
vg1207570300 A -> G LOC_Os12g13480-LOC_Os12g13490 intergenic_region ; MODIFIER silent_mutation Average:50.178; most accessible tissue: Minghui63 flower, score: 62.973 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207570300 8.12E-08 1.03E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 9.02E-07 2.69E-12 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 1.33E-07 1.18E-07 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 1.87E-08 NA mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 NA 6.89E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 8.45E-07 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 4.57E-11 3.67E-13 mr1079 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 5.03E-09 6.63E-11 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 2.86E-07 NA mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 2.38E-10 6.21E-13 mr1178 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 2.43E-06 8.49E-09 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 2.16E-11 1.22E-13 mr1390 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 7.72E-07 2.49E-07 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 2.13E-10 1.01E-12 mr1490 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 4.09E-08 4.39E-11 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 NA 3.65E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 NA 9.72E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 1.86E-06 NA mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 3.36E-06 NA mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 2.59E-07 NA mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 6.87E-06 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 NA 3.73E-08 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 2.63E-09 NA mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 NA 2.18E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 1.32E-09 1.07E-11 mr1490_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 NA 4.93E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300 NA 4.81E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251