Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207570300:

Variant ID: vg1207570300 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7570300
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CACTGCAAGAGCCATATGTGTTGTGTCATCAGTGATCTCATTTAGTGTTGGTGTTGAATCCATAGACCTGAGGTTATCATGGTTTCTAACATGTGTAGTA[A/G]
CTTACTCAGGGACTGCTAAACGCTACTCCGTAACTGGATAGTTATAAAAGTAGTTTTCGGGTATGCTATGAAACATGCAGTGGGATATGAATAATCAAGA

Reverse complement sequence

TCTTGATTATTCATATCCCACTGCATGTTTCATAGCATACCCGAAAACTACTTTTATAACTATCCAGTTACGGAGTAGCGTTTAGCAGTCCCTGAGTAAG[T/C]
TACTACACATGTTAGAAACCATGATAACCTCAGGTCTATGGATTCAACACCAACACTAAATGAGATCACTGATGACACAACACATATGGCTCTTGCAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	28.50%	0.51%	2.98%	NA
All Indica	2759	92.40%	2.20%	0.40%	5.04%	NA
All Japonica	1512	18.60%	80.60%	0.79%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	82.00%	1.50%	1.34%	15.13%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	96.50%	1.30%	0.33%	1.86%	NA
Indica Intermediate	786	93.10%	2.80%	0.00%	4.07%	NA
Temperate Japonica	767	21.00%	77.60%	1.43%	0.00%	NA
Tropical Japonica	504	8.50%	91.50%	0.00%	0.00%	NA
Japonica Intermediate	241	32.00%	67.60%	0.41%	0.00%	NA
VI/Aromatic	96	71.90%	27.10%	0.00%	1.04%	NA
Intermediate	90	54.40%	43.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207570300	A -> DEL	N	N	silent_mutation	Average:50.178; most accessible tissue: Minghui63 flower, score: 62.973	N	N	N	N
vg1207570300	A -> G	LOC_Os12g13490.1	upstream_gene_variant ; 4272.0bp to feature; MODIFIER	silent_mutation	Average:50.178; most accessible tissue: Minghui63 flower, score: 62.973	N	N	N	N
vg1207570300	A -> G	LOC_Os12g13480.1	downstream_gene_variant ; 4035.0bp to feature; MODIFIER	silent_mutation	Average:50.178; most accessible tissue: Minghui63 flower, score: 62.973	N	N	N	N
vg1207570300	A -> G	LOC_Os12g13480-LOC_Os12g13490	intergenic_region ; MODIFIER	silent_mutation	Average:50.178; most accessible tissue: Minghui63 flower, score: 62.973	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207570300	8.12E-08	1.03E-12	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	9.02E-07	2.69E-12	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	1.33E-07	1.18E-07	mr1018	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	1.87E-08	NA	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	NA	6.89E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	8.45E-07	NA	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	4.57E-11	3.67E-13	mr1079	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	5.03E-09	6.63E-11	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	2.86E-07	NA	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	2.38E-10	6.21E-13	mr1178	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	2.43E-06	8.49E-09	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	2.16E-11	1.22E-13	mr1390	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	7.72E-07	2.49E-07	mr1489	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	2.13E-10	1.01E-12	mr1490	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	4.09E-08	4.39E-11	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	NA	3.65E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	NA	9.72E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	1.86E-06	NA	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	3.36E-06	NA	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	2.59E-07	NA	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	6.87E-06	NA	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	NA	3.73E-08	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	2.63E-09	NA	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	NA	2.18E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	1.32E-09	1.07E-11	mr1490_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	NA	4.93E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207570300	NA	4.81E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251