\
| Variant ID: vg1207556909 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7556909 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, C: 0.20, others allele: 0.00, population size: 93. )
GGTTCAAAAGAGGCACGACACTTTATGATCTTTAGTCAGATTGGTGTTATCAACCTGGACTAAATATCATTTTTAGTCCTGGTTTAACACGTTGTCAGGC[T/C]
GTGTCAGGCCCTCCACTATTTTTAGTCCCGGTTGTTTATACCAGCCGGGACCAAAGATTGAAAAAAAAACCGCTCCCACACGCACCTCCTCTTCTCCTTT
AAAGGAGAAGAGGAGGTGCGTGTGGGAGCGGTTTTTTTTTCAATCTTTGGTCCCGGCTGGTATAAACAACCGGGACTAAAAATAGTGGAGGGCCTGACAC[A/G]
GCCTGACAACGTGTTAAACCAGGACTAAAAATGATATTTAGTCCAGGTTGATAACACCAATCTGACTAAAGATCATAAAGTGTCGTGCCTCTTTTGAACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 43.70% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 10.60% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.40% | 14.00% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 67.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207556909 | T -> C | LOC_Os12g13460.1 | downstream_gene_variant ; 2602.0bp to feature; MODIFIER | silent_mutation | Average:62.114; most accessible tissue: Callus, score: 88.417 | N | N | N | N |
| vg1207556909 | T -> C | LOC_Os12g13470.1 | downstream_gene_variant ; 4990.0bp to feature; MODIFIER | silent_mutation | Average:62.114; most accessible tissue: Callus, score: 88.417 | N | N | N | N |
| vg1207556909 | T -> C | LOC_Os12g13460-LOC_Os12g13470 | intergenic_region ; MODIFIER | silent_mutation | Average:62.114; most accessible tissue: Callus, score: 88.417 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207556909 | NA | 8.34E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207556909 | NA | 1.09E-13 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207556909 | NA | 2.77E-09 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207556909 | 2.93E-06 | 8.77E-07 | mr1350 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207556909 | NA | 4.62E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207556909 | NA | 6.19E-07 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |