Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207511374:

Variant ID: vg1207511374 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 7511374
Reference Allele: AT	Alternative Allele: TT,A
Primary Allele: AT	Secondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCTAGGGATTTACAATAGGAGTGATCTTGGTGCTGTAAATAAACAATTATTTTAGACGGTCTACACGTTTAATTTAAGATACACTTGAGCAGCTTTAGT[AT/TT,A]
TTTTTTCATCAAATCAACAATCCAAGACCATGTTGGCTATTTGCTTTACTATTATATCATATTATATCTTATAGGTCCTCCTCATACATATATTATACAA

Reverse complement sequence

TTGTATAATATATGTATGAGGAGGACCTATAAGATATAATATGATATAATAGTAAAGCAAATAGCCAACATGGTCTTGGATTGTTGATTTGATGAAAAAA[AT/AA,T]
ACTAAAGCTGCTCAAGTGTATCTTAAATTAAACGTGTAGACCGTCTAAAATAATTGTTTATTTACAGCACCAAGATCACTCCTATTGTAAATCCCTAGCG

Allele Frequencies:

Populations	Population Size	Frequency of AT(primary allele)	Frequency of TT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	16.80%	0.42%	0.95%	A: 0.02%
All Indica	2759	71.80%	27.20%	0.36%	0.62%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	75.50%	11.20%	2.97%	10.04%	A: 0.37%
Indica I	595	57.80%	41.80%	0.34%	0.00%	NA
Indica II	465	95.90%	4.10%	0.00%	0.00%	NA
Indica III	913	72.90%	25.50%	0.22%	1.31%	NA
Indica Intermediate	786	66.80%	31.80%	0.76%	0.64%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	2.10%	2.08%	1.04%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207511374	AT -> DEL	N	N	silent_mutation	Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1207511374	AT -> A	LOC_Os12g13420.1	upstream_gene_variant ; 4065.0bp to feature; MODIFIER	silent_mutation	Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1207511374	AT -> A	LOC_Os12g13420-LOC_Os12g13430	intergenic_region ; MODIFIER	silent_mutation	Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1207511374	AT -> TT	LOC_Os12g13420.1	upstream_gene_variant ; 4064.0bp to feature; MODIFIER	silent_mutation	Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1207511374	AT -> TT	LOC_Os12g13420-LOC_Os12g13430	intergenic_region ; MODIFIER	silent_mutation	Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207511374	NA	3.14E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	3.42E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	2.71E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	4.06E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	1.11E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	6.80E-08	5.25E-08	mr1363_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	3.46E-06	NA	mr1363_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	6.13E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	5.15E-06	mr1516_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	2.25E-06	NA	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	1.05E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	1.46E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	1.29E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	1.55E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	6.49E-09	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	1.34E-07	1.08E-13	mr1835_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	4.71E-06	2.43E-06	mr1835_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	1.27E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	7.27E-06	4.37E-15	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	9.91E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374	NA	8.81E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251