\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207511374:

Variant ID: vg1207511374 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 7511374
Reference Allele: ATAlternative Allele: TT,A
Primary Allele: ATSecondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCTAGGGATTTACAATAGGAGTGATCTTGGTGCTGTAAATAAACAATTATTTTAGACGGTCTACACGTTTAATTTAAGATACACTTGAGCAGCTTTAGT[AT/TT,A]
TTTTTTCATCAAATCAACAATCCAAGACCATGTTGGCTATTTGCTTTACTATTATATCATATTATATCTTATAGGTCCTCCTCATACATATATTATACAA

Reverse complement sequence

TTGTATAATATATGTATGAGGAGGACCTATAAGATATAATATGATATAATAGTAAAGCAAATAGCCAACATGGTCTTGGATTGTTGATTTGATGAAAAAA[AT/AA,T]
ACTAAAGCTGCTCAAGTGTATCTTAAATTAAACGTGTAGACCGTCTAAAATAATTGTTTATTTACAGCACCAAGATCACTCCTATTGTAAATCCCTAGCG

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of TT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 16.80% 0.42% 0.95% A: 0.02%
All Indica  2759 71.80% 27.20% 0.36% 0.62% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 75.50% 11.20% 2.97% 10.04% A: 0.37%
Indica I  595 57.80% 41.80% 0.34% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 72.90% 25.50% 0.22% 1.31% NA
Indica Intermediate  786 66.80% 31.80% 0.76% 0.64% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 2.10% 2.08% 1.04% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207511374 AT -> DEL N N silent_mutation Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1207511374 AT -> A LOC_Os12g13420.1 upstream_gene_variant ; 4065.0bp to feature; MODIFIER silent_mutation Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1207511374 AT -> A LOC_Os12g13420-LOC_Os12g13430 intergenic_region ; MODIFIER silent_mutation Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1207511374 AT -> TT LOC_Os12g13420.1 upstream_gene_variant ; 4064.0bp to feature; MODIFIER silent_mutation Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1207511374 AT -> TT LOC_Os12g13420-LOC_Os12g13430 intergenic_region ; MODIFIER silent_mutation Average:34.787; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207511374 NA 3.14E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 3.42E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 2.71E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 4.06E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 1.11E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 6.80E-08 5.25E-08 mr1363_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 3.46E-06 NA mr1363_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 6.13E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 5.15E-06 mr1516_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 2.25E-06 NA mr1547_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 1.05E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 1.46E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 1.29E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 1.55E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 6.49E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 1.34E-07 1.08E-13 mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 4.71E-06 2.43E-06 mr1835_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 1.27E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 7.27E-06 4.37E-15 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 9.91E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207511374 NA 8.81E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251