Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207492115:

Variant ID: vg1207492115 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7492115
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AGTACCGGTTGGTAATACCAACCGAGACAAAATGTTTTCAGGGACTTGGACTTTTAGAACCAGTACTAAAACATTTTTAGTACCGGTTCTAAATCTAGCT[G/A]
AGATATTTGTGATTTTTGATACCACGATGAAAGATCAGTTGTTAAGTATTGGTAGCACATGCATGTAATGGCTGTTCATGCAAACTGTAAAGTCACACTA

Reverse complement sequence

TAGTGTGACTTTACAGTTTGCATGAACAGCCATTACATGCATGTGCTACCAATACTTAACAACTGATCTTTCATCGTGGTATCAAAAATCACAAATATCT[C/T]
AGCTAGATTTAGAACCGGTACTAAAAATGTTTTAGTACTGGTTCTAAAAGTCCAAGTCCCTGAAAACATTTTGTCTCGGTTGGTATTACCAACCGGTACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	10.60%	0.00%	0.00%	NA
All Indica	2759	91.50%	8.50%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	27.10%	72.90%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	90.80%	9.20%	0.00%	0.00%	NA
Indica III	913	92.40%	7.60%	0.00%	0.00%	NA
Indica Intermediate	786	85.20%	14.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	42.70%	57.30%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207492115	G -> A	LOC_Os12g13390.1	upstream_gene_variant ; 2337.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1207492115	G -> A	LOC_Os12g13400.1	upstream_gene_variant ; 4470.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1207492115	G -> A	LOC_Os12g13390.3	upstream_gene_variant ; 2614.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1207492115	G -> A	LOC_Os12g13390.2	upstream_gene_variant ; 2337.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1207492115	G -> A	LOC_Os12g13390-LOC_Os12g13400	intergenic_region ; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207492115	8.64E-06	6.09E-07	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115	NA	5.34E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115	1.50E-06	NA	mr1482	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115	NA	8.30E-07	mr1522	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115	NA	1.48E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115	NA	1.30E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251