\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207492115:

Variant ID: vg1207492115 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7492115
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AGTACCGGTTGGTAATACCAACCGAGACAAAATGTTTTCAGGGACTTGGACTTTTAGAACCAGTACTAAAACATTTTTAGTACCGGTTCTAAATCTAGCT[G/A]
AGATATTTGTGATTTTTGATACCACGATGAAAGATCAGTTGTTAAGTATTGGTAGCACATGCATGTAATGGCTGTTCATGCAAACTGTAAAGTCACACTA

Reverse complement sequence

TAGTGTGACTTTACAGTTTGCATGAACAGCCATTACATGCATGTGCTACCAATACTTAACAACTGATCTTTCATCGTGGTATCAAAAATCACAAATATCT[C/T]
AGCTAGATTTAGAACCGGTACTAAAAATGTTTTAGTACTGGTTCTAAAAGTCCAAGTCCCTGAAAACATTTTGTCTCGGTTGGTATTACCAACCGGTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 10.60% 0.00% 0.00% NA
All Indica  2759 91.50% 8.50% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 27.10% 72.90% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 92.40% 7.60% 0.00% 0.00% NA
Indica Intermediate  786 85.20% 14.80% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207492115 G -> A LOC_Os12g13390.1 upstream_gene_variant ; 2337.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1207492115 G -> A LOC_Os12g13400.1 upstream_gene_variant ; 4470.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1207492115 G -> A LOC_Os12g13390.3 upstream_gene_variant ; 2614.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1207492115 G -> A LOC_Os12g13390.2 upstream_gene_variant ; 2337.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1207492115 G -> A LOC_Os12g13390-LOC_Os12g13400 intergenic_region ; MODIFIER silent_mutation Average:52.491; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207492115 8.64E-06 6.09E-07 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115 NA 5.34E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115 1.50E-06 NA mr1482 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115 NA 8.30E-07 mr1522 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115 NA 1.48E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207492115 NA 1.30E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251