\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207457491:

Variant ID: vg1207457491 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7457491
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCGGCCGGAACGCGAATGATAGGATTTAGGCCCCGAAGGAGAGAGAAGATTGAGCGGCGAGCTCCGGTGGCGAACGTGGCTGGGTGAGCGCGTCAAAA[C/A,T]
GTGTTCCCGGACGAGAAGGTTCCATTTTTTTGGTTAGTTGATAGAGATGAAGCGTCGGCCATGCCGACCACGGTGGCAGCCATGGTGGCAGACAGGAGCA

Reverse complement sequence

TGCTCCTGTCTGCCACCATGGCTGCCACCGTGGTCGGCATGGCCGACGCTTCATCTCTATCAACTAACCAAAAAAATGGAACCTTCTCGTCCGGGAACAC[G/T,A]
TTTTGACGCGCTCACCCAGCCACGTTCGCCACCGGAGCTCGCCGCTCAATCTTCTCTCTCCTTCGGGGCCTAAATCCTATCATTCGCGTTCCGGCCGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.40% 25.50% 2.86% 36.69% T: 0.61%
All Indica  2759 3.40% 43.10% 4.24% 48.53% T: 0.80%
All Japonica  1512 94.60% 0.30% 0.26% 4.76% T: 0.07%
Aus  269 1.90% 0.40% 3.35% 92.94% T: 1.49%
Indica I  595 3.00% 39.70% 3.19% 53.95% T: 0.17%
Indica II  465 4.30% 48.40% 2.80% 43.01% T: 1.51%
Indica III  913 2.80% 39.60% 5.48% 51.15% T: 0.88%
Indica Intermediate  786 3.70% 46.40% 4.45% 44.66% T: 0.76%
Temperate Japonica  767 94.90% 0.10% 0.26% 4.69% NA
Tropical Japonica  504 93.30% 0.60% 0.40% 5.56% T: 0.20%
Japonica Intermediate  241 96.30% 0.40% 0.00% 3.32% NA
VI/Aromatic  96 41.70% 1.00% 3.12% 52.08% T: 2.08%
Intermediate  90 62.20% 10.00% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207457491 C -> DEL N N silent_mutation Average:12.851; most accessible tissue: Callus, score: 69.982 N N N N
vg1207457491 C -> A LOC_Os12g13350.1 upstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:12.851; most accessible tissue: Callus, score: 69.982 N N N N
vg1207457491 C -> A LOC_Os12g13360.1 downstream_gene_variant ; 3937.0bp to feature; MODIFIER silent_mutation Average:12.851; most accessible tissue: Callus, score: 69.982 N N N N
vg1207457491 C -> A LOC_Os12g13350-LOC_Os12g13360 intergenic_region ; MODIFIER silent_mutation Average:12.851; most accessible tissue: Callus, score: 69.982 N N N N
vg1207457491 C -> T LOC_Os12g13350.1 upstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:12.851; most accessible tissue: Callus, score: 69.982 N N N N
vg1207457491 C -> T LOC_Os12g13360.1 downstream_gene_variant ; 3937.0bp to feature; MODIFIER silent_mutation Average:12.851; most accessible tissue: Callus, score: 69.982 N N N N
vg1207457491 C -> T LOC_Os12g13350-LOC_Os12g13360 intergenic_region ; MODIFIER silent_mutation Average:12.851; most accessible tissue: Callus, score: 69.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207457491 NA 9.73E-10 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 3.60E-34 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 1.59E-09 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 1.42E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 4.96E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 8.45E-06 1.14E-09 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 1.52E-22 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 6.43E-08 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 2.49E-07 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 8.59E-06 2.74E-06 mr1713 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 2.42E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 6.55E-08 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 1.45E-11 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 4.50E-38 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 1.44E-10 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 4.74E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 4.08E-24 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 7.67E-08 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 1.34E-35 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 5.80E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 1.96E-10 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491 NA 9.80E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251