Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207457491:

Variant ID: vg1207457491 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7457491
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCGGCCGGAACGCGAATGATAGGATTTAGGCCCCGAAGGAGAGAGAAGATTGAGCGGCGAGCTCCGGTGGCGAACGTGGCTGGGTGAGCGCGTCAAAA[C/A,T]
GTGTTCCCGGACGAGAAGGTTCCATTTTTTTGGTTAGTTGATAGAGATGAAGCGTCGGCCATGCCGACCACGGTGGCAGCCATGGTGGCAGACAGGAGCA

Reverse complement sequence

TGCTCCTGTCTGCCACCATGGCTGCCACCGTGGTCGGCATGGCCGACGCTTCATCTCTATCAACTAACCAAAAAAATGGAACCTTCTCGTCCGGGAACAC[G/T,A]
TTTTGACGCGCTCACCCAGCCACGTTCGCCACCGGAGCTCGCCGCTCAATCTTCTCTCTCCTTCGGGGCCTAAATCCTATCATTCGCGTTCCGGCCGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.40%	25.50%	2.86%	36.69%	T: 0.61%
All Indica	2759	3.40%	43.10%	4.24%	48.53%	T: 0.80%
All Japonica	1512	94.60%	0.30%	0.26%	4.76%	T: 0.07%
Aus	269	1.90%	0.40%	3.35%	92.94%	T: 1.49%
Indica I	595	3.00%	39.70%	3.19%	53.95%	T: 0.17%
Indica II	465	4.30%	48.40%	2.80%	43.01%	T: 1.51%
Indica III	913	2.80%	39.60%	5.48%	51.15%	T: 0.88%
Indica Intermediate	786	3.70%	46.40%	4.45%	44.66%	T: 0.76%
Temperate Japonica	767	94.90%	0.10%	0.26%	4.69%	NA
Tropical Japonica	504	93.30%	0.60%	0.40%	5.56%	T: 0.20%
Japonica Intermediate	241	96.30%	0.40%	0.00%	3.32%	NA
VI/Aromatic	96	41.70%	1.00%	3.12%	52.08%	T: 2.08%
Intermediate	90	62.20%	10.00%	2.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207457491	C -> DEL	N	N	silent_mutation	Average:12.851; most accessible tissue: Callus, score: 69.982	N	N	N	N
vg1207457491	C -> A	LOC_Os12g13350.1	upstream_gene_variant ; 3952.0bp to feature; MODIFIER	silent_mutation	Average:12.851; most accessible tissue: Callus, score: 69.982	N	N	N	N
vg1207457491	C -> A	LOC_Os12g13360.1	downstream_gene_variant ; 3937.0bp to feature; MODIFIER	silent_mutation	Average:12.851; most accessible tissue: Callus, score: 69.982	N	N	N	N
vg1207457491	C -> A	LOC_Os12g13350-LOC_Os12g13360	intergenic_region ; MODIFIER	silent_mutation	Average:12.851; most accessible tissue: Callus, score: 69.982	N	N	N	N
vg1207457491	C -> T	LOC_Os12g13350.1	upstream_gene_variant ; 3952.0bp to feature; MODIFIER	silent_mutation	Average:12.851; most accessible tissue: Callus, score: 69.982	N	N	N	N
vg1207457491	C -> T	LOC_Os12g13360.1	downstream_gene_variant ; 3937.0bp to feature; MODIFIER	silent_mutation	Average:12.851; most accessible tissue: Callus, score: 69.982	N	N	N	N
vg1207457491	C -> T	LOC_Os12g13350-LOC_Os12g13360	intergenic_region ; MODIFIER	silent_mutation	Average:12.851; most accessible tissue: Callus, score: 69.982	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207457491	NA	9.73E-10	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	3.60E-34	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	1.59E-09	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	1.42E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	4.96E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	8.45E-06	1.14E-09	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	1.52E-22	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	6.43E-08	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	2.49E-07	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	8.59E-06	2.74E-06	mr1713	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	2.42E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	6.55E-08	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	1.45E-11	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	4.50E-38	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	1.44E-10	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	4.74E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	4.08E-24	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	7.67E-08	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	1.34E-35	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	5.80E-09	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	1.96E-10	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207457491	NA	9.80E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251