Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207456835:

Variant ID: vg1207456835 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7456835
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGGTATCAATATGATCAAAGATTGGAACTGTGGCTTGCCTTGTGGAACGTGGCCTTCTGAAGCTTCAGCGTAGCCTTCTAGGTCCACTTCAGTTCCTG[T/C]
GTGCCCGGTGGGATTTTCAATACGATCTAACGTACGCACACGAAGAAACGACCAAATAAGCCTATAATAAAAATACTACAAATAAACGATAAAATAAATA

Reverse complement sequence

TATTTATTTTATCGTTTATTTGTAGTATTTTTATTATAGGCTTATTTGGTCGTTTCTTCGTGTGCGTACGTTAGATCGTATTGAAAATCCCACCGGGCAC[A/G]
CAGGAACTGAAGTGGACCTAGAAGGCTACGCTGAAGCTTCAGAAGGCCACGTTCCACAAGGCAAGCCACAGTTCCAATCTTTGATCATATTGATACCTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	9.90%	21.12%	34.00%	NA
All Indica	2759	4.30%	16.80%	34.51%	44.36%	NA
All Japonica	1512	94.60%	0.10%	0.99%	4.30%	NA
Aus	269	1.50%	0.00%	7.06%	91.45%	NA
Indica I	595	5.20%	18.70%	20.84%	55.29%	NA
Indica II	465	5.20%	25.20%	31.83%	37.85%	NA
Indica III	913	2.40%	10.70%	43.37%	43.48%	NA
Indica Intermediate	786	5.50%	17.40%	36.13%	40.97%	NA
Temperate Japonica	767	94.90%	0.00%	0.39%	4.69%	NA
Tropical Japonica	504	93.30%	0.20%	1.98%	4.56%	NA
Japonica Intermediate	241	96.70%	0.00%	0.83%	2.49%	NA
VI/Aromatic	96	41.70%	1.00%	6.25%	51.04%	NA
Intermediate	90	63.30%	4.40%	6.67%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207456835	T -> C	LOC_Os12g13350.1	upstream_gene_variant ; 3296.0bp to feature; MODIFIER	silent_mutation	Average:13.259; most accessible tissue: Callus, score: 43.936	N	N	N	N
vg1207456835	T -> C	LOC_Os12g13360.1	downstream_gene_variant ; 4593.0bp to feature; MODIFIER	silent_mutation	Average:13.259; most accessible tissue: Callus, score: 43.936	N	N	N	N
vg1207456835	T -> C	LOC_Os12g13350-LOC_Os12g13360	intergenic_region ; MODIFIER	silent_mutation	Average:13.259; most accessible tissue: Callus, score: 43.936	N	N	N	N
vg1207456835	T -> DEL	N	N	silent_mutation	Average:13.259; most accessible tissue: Callus, score: 43.936	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207456835	NA	4.53E-08	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	8.67E-07	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	1.56E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	1.70E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	2.73E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	1.01E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	1.93E-06	5.49E-10	mr1236	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	2.32E-18	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	2.83E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	1.68E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	3.56E-07	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	1.54E-09	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	3.33E-08	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	8.42E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	6.48E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	1.81E-22	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	7.21E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	3.21E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	8.57E-06	mr1553_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835	NA	3.68E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251