\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207456835:

Variant ID: vg1207456835 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7456835
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGGTATCAATATGATCAAAGATTGGAACTGTGGCTTGCCTTGTGGAACGTGGCCTTCTGAAGCTTCAGCGTAGCCTTCTAGGTCCACTTCAGTTCCTG[T/C]
GTGCCCGGTGGGATTTTCAATACGATCTAACGTACGCACACGAAGAAACGACCAAATAAGCCTATAATAAAAATACTACAAATAAACGATAAAATAAATA

Reverse complement sequence

TATTTATTTTATCGTTTATTTGTAGTATTTTTATTATAGGCTTATTTGGTCGTTTCTTCGTGTGCGTACGTTAGATCGTATTGAAAATCCCACCGGGCAC[A/G]
CAGGAACTGAAGTGGACCTAGAAGGCTACGCTGAAGCTTCAGAAGGCCACGTTCCACAAGGCAAGCCACAGTTCCAATCTTTGATCATATTGATACCTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 9.90% 21.12% 34.00% NA
All Indica  2759 4.30% 16.80% 34.51% 44.36% NA
All Japonica  1512 94.60% 0.10% 0.99% 4.30% NA
Aus  269 1.50% 0.00% 7.06% 91.45% NA
Indica I  595 5.20% 18.70% 20.84% 55.29% NA
Indica II  465 5.20% 25.20% 31.83% 37.85% NA
Indica III  913 2.40% 10.70% 43.37% 43.48% NA
Indica Intermediate  786 5.50% 17.40% 36.13% 40.97% NA
Temperate Japonica  767 94.90% 0.00% 0.39% 4.69% NA
Tropical Japonica  504 93.30% 0.20% 1.98% 4.56% NA
Japonica Intermediate  241 96.70% 0.00% 0.83% 2.49% NA
VI/Aromatic  96 41.70% 1.00% 6.25% 51.04% NA
Intermediate  90 63.30% 4.40% 6.67% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207456835 T -> C LOC_Os12g13350.1 upstream_gene_variant ; 3296.0bp to feature; MODIFIER silent_mutation Average:13.259; most accessible tissue: Callus, score: 43.936 N N N N
vg1207456835 T -> C LOC_Os12g13360.1 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:13.259; most accessible tissue: Callus, score: 43.936 N N N N
vg1207456835 T -> C LOC_Os12g13350-LOC_Os12g13360 intergenic_region ; MODIFIER silent_mutation Average:13.259; most accessible tissue: Callus, score: 43.936 N N N N
vg1207456835 T -> DEL N N silent_mutation Average:13.259; most accessible tissue: Callus, score: 43.936 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207456835 NA 4.53E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 8.67E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 1.56E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 1.70E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 2.73E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 1.01E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 1.93E-06 5.49E-10 mr1236 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 2.32E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 2.83E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 1.68E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 3.56E-07 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 1.54E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 3.33E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 8.42E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 6.48E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 1.81E-22 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 7.21E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 3.21E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 8.57E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207456835 NA 3.68E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251