\
| Variant ID: vg1207412253 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7412253 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 109. )
TTTCACTTGGTGTGATTTTTCTCCGTTGCAACGCATGGGCACCCTACTAGTATAAGGGATTTTGAGTTTTTGTTTGAATTGTTTGACCACTCGTCTTATT[C/T]
AAAAAATTTGTGTAAATATAAAAAATGAAAAGTTGTGCTTAAAGTACTTTGAATAATAAAGTAAATCACAAAAAAATAAATAATAATTCCAAAATTTTTT
AAAAAATTTTGGAATTATTATTTATTTTTTTGTGATTTACTTTATTATTCAAAGTACTTTAAGCACAACTTTTCATTTTTTATATTTACACAAATTTTTT[G/A]
AATAAGACGAGTGGTCAAACAATTCAAACAAAAACTCAAAATCCCTTATACTAGTAGGGTGCCCATGCGTTGCAACGGAGAAAAATCACACCAAGTGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.60% | 21.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 73.50% | 26.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 50.80% | 49.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.10% | 16.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 64.50% | 35.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 33.30% | 66.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207412253 | C -> T | LOC_Os12g13295.1 | downstream_gene_variant ; 368.0bp to feature; MODIFIER | silent_mutation | Average:45.176; most accessible tissue: Callus, score: 62.519 | N | N | N | N |
| vg1207412253 | C -> T | LOC_Os12g13295-LOC_Os12g13300 | intergenic_region ; MODIFIER | silent_mutation | Average:45.176; most accessible tissue: Callus, score: 62.519 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207412253 | NA | 9.07E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207412253 | NA | 6.60E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207412253 | NA | 2.10E-06 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207412253 | NA | 5.66E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207412253 | NA | 1.10E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207412253 | 1.18E-06 | 1.18E-06 | mr1866 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207412253 | NA | 8.72E-07 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |