\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207412253:

Variant ID: vg1207412253 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7412253
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCACTTGGTGTGATTTTTCTCCGTTGCAACGCATGGGCACCCTACTAGTATAAGGGATTTTGAGTTTTTGTTTGAATTGTTTGACCACTCGTCTTATT[C/T]
AAAAAATTTGTGTAAATATAAAAAATGAAAAGTTGTGCTTAAAGTACTTTGAATAATAAAGTAAATCACAAAAAAATAAATAATAATTCCAAAATTTTTT

Reverse complement sequence

AAAAAATTTTGGAATTATTATTTATTTTTTTGTGATTTACTTTATTATTCAAAGTACTTTAAGCACAACTTTTCATTTTTTATATTTACACAAATTTTTT[G/A]
AATAAGACGAGTGGTCAAACAATTCAAACAAAAACTCAAAATCCCTTATACTAGTAGGGTGCCCATGCGTTGCAACGGAGAAAAATCACACCAAGTGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.40% 0.00% 0.00% NA
All Indica  2759 73.50% 26.50% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 27.10% 72.90% 0.00% 0.00% NA
Indica I  595 88.20% 11.80% 0.00% 0.00% NA
Indica II  465 50.80% 49.20% 0.00% 0.00% NA
Indica III  913 83.10% 16.90% 0.00% 0.00% NA
Indica Intermediate  786 64.50% 35.50% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207412253 C -> T LOC_Os12g13295.1 downstream_gene_variant ; 368.0bp to feature; MODIFIER silent_mutation Average:45.176; most accessible tissue: Callus, score: 62.519 N N N N
vg1207412253 C -> T LOC_Os12g13295-LOC_Os12g13300 intergenic_region ; MODIFIER silent_mutation Average:45.176; most accessible tissue: Callus, score: 62.519 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207412253 NA 9.07E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207412253 NA 6.60E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207412253 NA 2.10E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207412253 NA 5.66E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207412253 NA 1.10E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207412253 1.18E-06 1.18E-06 mr1866 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207412253 NA 8.72E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251