\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207399610:

Variant ID: vg1207399610 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7399610
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCCGAACTTAATTTTTTTTTGTCCAAAATAAGCTTAATTCTATGCGCGGTAGACCGGAAAACCATAATTTTTTAAAATCGACTCGGTCCGAACGGTCC[C/T,A]
GGACTTAATATTTTTTTTTTGTCCGAAATAAATTGTTCTACTTTACGATCGATCGAAAAACCTTTTTTAAAATCAACGCGATCTACACGGTCCAGACCGT

Reverse complement sequence

ACGGTCTGGACCGTGTAGATCGCGTTGATTTTAAAAAAGGTTTTTCGATCGATCGTAAAGTAGAACAATTTATTTCGGACAAAAAAAAAATATTAAGTCC[G/A,T]
GGACCGTTCGGACCGAGTCGATTTTAAAAAATTATGGTTTTCCGGTCTACCGCGCATAGAATTAAGCTTATTTTGGACAAAAAAAAATTAAGTTCGGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.80% 0.15% 0.00% A: 0.06%
All Indica  2759 44.40% 55.50% 0.11% 0.00% NA
All Japonica  1512 98.30% 1.30% 0.26% 0.00% A: 0.20%
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 67.70% 32.10% 0.17% 0.00% NA
Indica II  465 54.80% 44.90% 0.22% 0.00% NA
Indica III  913 28.30% 71.60% 0.11% 0.00% NA
Indica Intermediate  786 39.30% 60.70% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 0.70% 0.39% 0.00% NA
Tropical Japonica  504 97.00% 2.40% 0.00% 0.00% A: 0.60%
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207399610 C -> A LOC_Os12g13290-LOC_Os12g13295 intergenic_region ; MODIFIER silent_mutation Average:73.097; most accessible tissue: Minghui63 flower, score: 83.493 N N N N
vg1207399610 C -> T LOC_Os12g13290-LOC_Os12g13295 intergenic_region ; MODIFIER silent_mutation Average:73.097; most accessible tissue: Minghui63 flower, score: 83.493 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207399610 NA 5.33E-07 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 8.90E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 2.75E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 1.31E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 2.90E-07 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 6.12E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 4.39E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 6.08E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 3.69E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 1.44E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 3.81E-11 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 4.00E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 9.00E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 5.46E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 1.33E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 9.66E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 6.22E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 4.22E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 3.95E-09 mr1882_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207399610 NA 5.33E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251