\
| Variant ID: vg1207399200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7399200 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, A: 0.11, others allele: 0.00, population size: 96. )
TCCTAAAACGGTATTATATGCGCAATTGACCGAAAAACCTTCAGATTTTCTAAAATCGTCCTGATCCAGTTTGTTCCGGACTTTTTTTTCCAAAATAAAC[C/A]
GTTCAGCTTCATTCTATGCGCGGTGGACTGAAAAACCATGATTTTTAAAATCGACCCGGTCGAGACGGTCCTCGACTTAATATTTTTCTGTCCAAAATAA
TTATTTTGGACAGAAAAATATTAAGTCGAGGACCGTCTCGACCGGGTCGATTTTAAAAATCATGGTTTTTCAGTCCACCGCGCATAGAATGAAGCTGAAC[G/T]
GTTTATTTTGGAAAAAAAAGTCCGGAACAAACTGGATCAGGACGATTTTAGAAAATCTGAAGGTTTTTCGGTCAATTGCGCATATAATACCGTTTTAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 39.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 44.80% | 55.00% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.20% | 88.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.60% | 31.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 54.80% | 45.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 27.80% | 72.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 40.60% | 59.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207399200 | C -> A | LOC_Os12g13290-LOC_Os12g13295 | intergenic_region ; MODIFIER | silent_mutation | Average:74.897; most accessible tissue: Callus, score: 87.335 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207399200 | NA | 1.60E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 1.92E-06 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 2.78E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 3.28E-07 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 4.61E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 6.21E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 7.60E-08 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 4.68E-08 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 8.21E-12 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | 3.86E-06 | 3.17E-08 | mr1576_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 8.32E-09 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 8.99E-09 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 4.05E-08 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 1.69E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 1.33E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 6.71E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207399200 | NA | 7.55E-09 | mr1882_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |