\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207398363:

Variant ID: vg1207398363 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7398363
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CTGACTCGTAGTCGATAACAGGGTAGTCTTCCTCCTCGAGTTTGTTTCAGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACAGTATCCGGAGACAC[C/T]
GTAGGGGACTAGCCGTGCTTATTCCTGAAGTCGATATCCGGCGTCTTTGTCTTGGCGTATGTTGGCTTGTATGTTGTGGCTTCTGTTGTTCCGTATATGT

Reverse complement sequence

ACATATACGGAACAACAGAAGCCACAACATACAAGCCAACATACGCCAAGACAAAGACGCCGGATATCGACTTCAGGAATAAGCACGGCTAGTCCCCTAC[G/A]
GTGTCTCCGGATACTGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCTGAAACAAACTCGAGGAGGAAGACTACCCTGTTATCGACTACGAGTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.80% 0.06% 0.00% NA
All Indica  2759 44.20% 55.70% 0.07% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 10.00% 89.60% 0.37% 0.00% NA
Indica I  595 67.70% 32.30% 0.00% 0.00% NA
Indica II  465 54.60% 45.40% 0.00% 0.00% NA
Indica III  913 27.90% 72.10% 0.00% 0.00% NA
Indica Intermediate  786 39.20% 60.60% 0.25% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207398363 C -> T LOC_Os12g13290.1 downstream_gene_variant ; 4512.0bp to feature; MODIFIER silent_mutation Average:56.377; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N
vg1207398363 C -> T LOC_Os12g13290-LOC_Os12g13295 intergenic_region ; MODIFIER silent_mutation Average:56.377; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207398363 C T 0.06 0.03 0.02 0.06 0.06 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207398363 NA 3.07E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 1.15E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 6.62E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 6.67E-08 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 6.94E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 2.89E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 7.05E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 2.03E-08 mr1582_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 3.99E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 6.29E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 3.06E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363 NA 1.91E-08 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251