\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207398039:

Variant ID: vg1207398039 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7398039
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCCAGTTGACATACGGAACAATATGGTTAGTCCGAAAATTGTTTTTAACCAAAACAATATAAGTGGGCTCATATGTGTCGACGTTTGATGTCGCGATT[T/C]
CAGTATTTGTATAGTATGGGGATCGTTGGGACTAGGATATATGCGAGACTGAGGTAAAAGAGATGGGACGAGGATTTTTATACAGGTTCGGGCTCCTGAA

Reverse complement sequence

TTCAGGAGCCCGAACCTGTATAAAAATCCTCGTCCCATCTCTTTTACCTCAGTCTCGCATATATCCTAGTCCCAACGATCCCCATACTATACAAATACTG[A/G]
AATCGCGACATCAAACGTCGACACATATGAGCCCACTTATATTGTTTTGGTTAAAAACAATTTTCGGACTAACCATATTGTTCCGTATGTCAACTGGGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 40.90% 0.06% 0.00% NA
All Indica  2759 84.60% 15.30% 0.11% 0.00% NA
All Japonica  1512 5.40% 94.60% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 54.80% 44.90% 0.22% 0.00% NA
Indica III  913 94.10% 5.80% 0.11% 0.00% NA
Indica Intermediate  786 81.80% 18.10% 0.13% 0.00% NA
Temperate Japonica  767 5.00% 95.00% 0.00% 0.00% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207398039 T -> C LOC_Os12g13290.1 downstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:59.604; most accessible tissue: Zhenshan97 flower, score: 76.961 N N N N
vg1207398039 T -> C LOC_Os12g13290-LOC_Os12g13295 intergenic_region ; MODIFIER silent_mutation Average:59.604; most accessible tissue: Zhenshan97 flower, score: 76.961 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207398039 NA 1.26E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 1.75E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 2.03E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 8.48E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 9.01E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 2.79E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 4.84E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 6.00E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 3.58E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 5.07E-08 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 5.96E-08 mr1355_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 5.89E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 3.87E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 7.96E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 1.58E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 9.69E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 6.11E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 3.77E-06 mr1719_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 2.12E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 6.49E-06 mr1815_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 4.00E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 2.62E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 1.20E-06 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 8.63E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 1.17E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 3.07E-08 mr1899_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 1.44E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 1.69E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398039 NA 5.50E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251