\
| Variant ID: vg1207382181 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7382181 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 113. )
ATCATATGTAGAAGAACTATTTTGTAAAACACATGAAGGGGTATTTGGTAACAACATAAACAATACTCTATATAATAGAATAGAGGTGGGGTAGCAGATT[A/G]
ACTGTCATCCTCTCCCTCTTCACTCCTCAAGGATTCGGCCAAGGTCTTGGATTTGGCATCTCAAGCCTACTGGAACACCTGGAGGCGAAAATGCAAAGGG
CCCTTTGCATTTTCGCCTCCAGGTGTTCCAGTAGGCTTGAGATGCCAAATCCAAGACCTTGGCCGAATCCTTGAGGAGTGAAGAGGGAGAGGATGACAGT[T/C]
AATCTGCTACCCCACCTCTATTCTATTATATAGAGTATTGTTTATGTTGTTACCAAATACCCCTTCATGTGTTTTACAAAATAGTTCTTCTACATATGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.70% | 9.20% | 0.04% | 1.08% | NA |
| All Indica | 2759 | 84.70% | 14.50% | 0.04% | 0.80% | NA |
| All Japonica | 1512 | 97.90% | 0.10% | 0.07% | 1.85% | NA |
| Aus | 269 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 0.60% | 0.00% | 3.44% | NA |
| Indica III | 913 | 84.20% | 15.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.80% | 18.30% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 96.20% | 0.30% | 0.13% | 3.39% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207382181 | A -> DEL | N | N | silent_mutation | Average:73.204; most accessible tissue: Zhenshan97 flower, score: 87.301 | N | N | N | N |
| vg1207382181 | A -> G | LOC_Os12g13280.1 | downstream_gene_variant ; 3525.0bp to feature; MODIFIER | silent_mutation | Average:73.204; most accessible tissue: Zhenshan97 flower, score: 87.301 | N | N | N | N |
| vg1207382181 | A -> G | LOC_Os12g13270.1 | intron_variant ; MODIFIER | silent_mutation | Average:73.204; most accessible tissue: Zhenshan97 flower, score: 87.301 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207382181 | NA | 2.59E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207382181 | NA | 9.33E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207382181 | NA | 1.55E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207382181 | NA | 3.01E-11 | mr1352_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207382181 | NA | 2.14E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207382181 | NA | 2.47E-08 | mr1474_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207382181 | NA | 2.68E-06 | mr1474_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207382181 | NA | 4.73E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |