\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207382181:

Variant ID: vg1207382181 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7382181
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATATGTAGAAGAACTATTTTGTAAAACACATGAAGGGGTATTTGGTAACAACATAAACAATACTCTATATAATAGAATAGAGGTGGGGTAGCAGATT[A/G]
ACTGTCATCCTCTCCCTCTTCACTCCTCAAGGATTCGGCCAAGGTCTTGGATTTGGCATCTCAAGCCTACTGGAACACCTGGAGGCGAAAATGCAAAGGG

Reverse complement sequence

CCCTTTGCATTTTCGCCTCCAGGTGTTCCAGTAGGCTTGAGATGCCAAATCCAAGACCTTGGCCGAATCCTTGAGGAGTGAAGAGGGAGAGGATGACAGT[T/C]
AATCTGCTACCCCACCTCTATTCTATTATATAGAGTATTGTTTATGTTGTTACCAAATACCCCTTCATGTGTTTTACAAAATAGTTCTTCTACATATGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 9.20% 0.04% 1.08% NA
All Indica  2759 84.70% 14.50% 0.04% 0.80% NA
All Japonica  1512 97.90% 0.10% 0.07% 1.85% NA
Aus  269 88.10% 11.90% 0.00% 0.00% NA
Indica I  595 81.80% 18.20% 0.00% 0.00% NA
Indica II  465 95.90% 0.60% 0.00% 3.44% NA
Indica III  913 84.20% 15.80% 0.00% 0.00% NA
Indica Intermediate  786 80.80% 18.30% 0.13% 0.76% NA
Temperate Japonica  767 96.20% 0.30% 0.13% 3.39% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207382181 A -> DEL N N silent_mutation Average:73.204; most accessible tissue: Zhenshan97 flower, score: 87.301 N N N N
vg1207382181 A -> G LOC_Os12g13280.1 downstream_gene_variant ; 3525.0bp to feature; MODIFIER silent_mutation Average:73.204; most accessible tissue: Zhenshan97 flower, score: 87.301 N N N N
vg1207382181 A -> G LOC_Os12g13270.1 intron_variant ; MODIFIER silent_mutation Average:73.204; most accessible tissue: Zhenshan97 flower, score: 87.301 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207382181 NA 2.59E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207382181 NA 9.33E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207382181 NA 1.55E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207382181 NA 3.01E-11 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207382181 NA 2.14E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207382181 NA 2.47E-08 mr1474_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207382181 NA 2.68E-06 mr1474_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207382181 NA 4.73E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251