\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207359848:

Variant ID: vg1207359848 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7359848
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGAGACATGCTGGCTTCACCAACTACTACATGAGTTACATGCTCCGTCATCCTGAGCTACTCTGGTTTGGTCTACTGTGACAATGTTAGTGTTGTGTA[T/A]
CTATTGACGGTTCTTAAATCGTAATATCTAACCATCAATGCCTGTATATAATGAAATAAAATATGGTATCCAATTTAGTAGTAGGGATTATTACTAATTA

Reverse complement sequence

TAATTAGTAATAATCCCTACTACTAAATTGGATACCATATTTTATTTCATTATATACAGGCATTGATGGTTAGATATTACGATTTAAGAACCGTCAATAG[A/T]
TACACAACACTAACATTGTCACAGTAGACCAAACCAGAGTAGCTCAGGATGACGGAGCATGTAACTCATGTAGTAGTTGGTGAAGCCAGCATGTCTCAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 7.90% 3.17% 25.58% NA
All Indica  2759 46.20% 13.20% 5.07% 35.52% NA
All Japonica  1512 99.30% 0.20% 0.07% 0.46% NA
Aus  269 36.10% 0.00% 1.49% 62.45% NA
Indica I  595 19.80% 37.60% 14.45% 28.07% NA
Indica II  465 38.90% 12.70% 2.37% 46.02% NA
Indica III  913 71.20% 0.20% 1.53% 27.05% NA
Indica Intermediate  786 41.30% 10.20% 3.69% 44.78% NA
Temperate Japonica  767 99.00% 0.40% 0.00% 0.65% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 45.80% 0.00% 3.12% 51.04% NA
Intermediate  90 84.40% 7.80% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207359848 T -> DEL N N silent_mutation Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg1207359848 T -> A LOC_Os12g13209.1 upstream_gene_variant ; 299.0bp to feature; MODIFIER silent_mutation Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg1207359848 T -> A LOC_Os12g13220.1 upstream_gene_variant ; 3583.0bp to feature; MODIFIER silent_mutation Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg1207359848 T -> A LOC_Os12g13230.1 downstream_gene_variant ; 4950.0bp to feature; MODIFIER silent_mutation Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg1207359848 T -> A LOC_Os12g13209-LOC_Os12g13220 intergenic_region ; MODIFIER silent_mutation Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207359848 NA 9.98E-07 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 2.68E-06 2.68E-06 mr1151_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 2.41E-08 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 1.40E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 5.38E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 3.17E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 3.68E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 9.09E-06 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 1.42E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 4.41E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207359848 NA 7.70E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251