\
| Variant ID: vg1207359848 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7359848 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTGAGACATGCTGGCTTCACCAACTACTACATGAGTTACATGCTCCGTCATCCTGAGCTACTCTGGTTTGGTCTACTGTGACAATGTTAGTGTTGTGTA[T/A]
CTATTGACGGTTCTTAAATCGTAATATCTAACCATCAATGCCTGTATATAATGAAATAAAATATGGTATCCAATTTAGTAGTAGGGATTATTACTAATTA
TAATTAGTAATAATCCCTACTACTAAATTGGATACCATATTTTATTTCATTATATACAGGCATTGATGGTTAGATATTACGATTTAAGAACCGTCAATAG[A/T]
TACACAACACTAACATTGTCACAGTAGACCAAACCAGAGTAGCTCAGGATGACGGAGCATGTAACTCATGTAGTAGTTGGTGAAGCCAGCATGTCTCAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 7.90% | 3.17% | 25.58% | NA |
| All Indica | 2759 | 46.20% | 13.20% | 5.07% | 35.52% | NA |
| All Japonica | 1512 | 99.30% | 0.20% | 0.07% | 0.46% | NA |
| Aus | 269 | 36.10% | 0.00% | 1.49% | 62.45% | NA |
| Indica I | 595 | 19.80% | 37.60% | 14.45% | 28.07% | NA |
| Indica II | 465 | 38.90% | 12.70% | 2.37% | 46.02% | NA |
| Indica III | 913 | 71.20% | 0.20% | 1.53% | 27.05% | NA |
| Indica Intermediate | 786 | 41.30% | 10.20% | 3.69% | 44.78% | NA |
| Temperate Japonica | 767 | 99.00% | 0.40% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 45.80% | 0.00% | 3.12% | 51.04% | NA |
| Intermediate | 90 | 84.40% | 7.80% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207359848 | T -> DEL | N | N | silent_mutation | Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| vg1207359848 | T -> A | LOC_Os12g13209.1 | upstream_gene_variant ; 299.0bp to feature; MODIFIER | silent_mutation | Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| vg1207359848 | T -> A | LOC_Os12g13220.1 | upstream_gene_variant ; 3583.0bp to feature; MODIFIER | silent_mutation | Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| vg1207359848 | T -> A | LOC_Os12g13230.1 | downstream_gene_variant ; 4950.0bp to feature; MODIFIER | silent_mutation | Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| vg1207359848 | T -> A | LOC_Os12g13209-LOC_Os12g13220 | intergenic_region ; MODIFIER | silent_mutation | Average:54.467; most accessible tissue: Zhenshan97 young leaf, score: 68.794 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207359848 | NA | 9.98E-07 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | 2.68E-06 | 2.68E-06 | mr1151_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 2.41E-08 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 1.40E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 5.38E-06 | mr1227_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 3.17E-06 | mr1266_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 3.68E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 9.09E-06 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 1.42E-06 | mr1578_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 4.41E-09 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207359848 | NA | 7.70E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |