\
| Variant ID: vg1207352435 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7352435 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 241. )
GGTCACAAAATATATGGCCGACCACAGTGCAAGTTATAAGAGAGGTTGACGCTAGTGGTAGGCCCACGGCGCCCAGAACTGTCATTGGAAGATGGTCTAA[C/T]
TGCTGCGGGCTGGCGGCACGTGAGAACTTCGGGATCCTCCATAAAGATATTGGCAAGGTCACAGAAGTCGAGAAAGAGCGAGCTTGGACGGCAATGGAGA
TCTCCATTGCCGTCCAAGCTCGCTCTTTCTCGACTTCTGTGACCTTGCCAATATCTTTATGGAGGATCCCGAAGTTCTCACGTGCCGCCAGCCCGCAGCA[G/A]
TTAGACCATCTTCCAATGACAGTTCTGGGCGCCGTGGGCCTACCACTAGCGTCAACCTCTCTTATAACTTGCACTGTGGTCGGCCATATATTTTGTGACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 12.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 86.50% | 13.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 46.80% | 53.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.80% | 17.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207352435 | C -> T | LOC_Os12g13200.1 | synonymous_variant ; p.Asn34Asn; LOW | synonymous_codon | Average:29.941; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207352435 | 5.54E-06 | NA | mr1036 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207352435 | NA | 4.32E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207352435 | NA | 8.57E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207352435 | NA | 5.16E-07 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207352435 | NA | 7.60E-07 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207352435 | NA | 5.27E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207352435 | NA | 1.78E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |