Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207329016:

Variant ID: vg1207329016 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 7329016
Reference Allele: C	Alternative Allele: T,CGCGGAAAACAA
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTTTTAAAAAATAGATTAATATGATTTTTTAAAACAACTTTTGTATAGAAACTTTTTTTAAAAAAAACACACCGTTTAACAATTTGAAAAACCTGCA[C/T,CGCGGAAAACAA]
GCGGAAAACAAGGGGGAGTTGGGAAGGGCTGGGAACGAACGTGTTGTGACATACCCAAATTTTGCGTGTAATTCTCAGAAGTGATTAACAATCTTTACGA

Reverse complement sequence

TCGTAAAGATTGTTAATCACTTCTGAGAATTACACGCAAAATTTGGGTATGTCACAACACGTTCGTTCCCAGCCCTTCCCAACTCCCCCTTGTTTTCCGC[G/A,TTGTTTTCCGCG]
TGCAGGTTTTTCAAATTGTTAAACGGTGTGTTTTTTTTAAAAAAAGTTTCTATACAAAAGTTGTTTTAAAAAATCATATTAATCTATTTTTTAAAAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	32.10%	0.19%	0.00%	CGCGGAAAACAA: 0.02%
All Indica	2759	46.70%	53.00%	0.29%	0.00%	CGCGGAAAACAA: 0.04%
All Japonica	1512	97.60%	2.40%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	33.10%	66.60%	0.34%	0.00%	NA
Indica II	465	60.20%	39.60%	0.22%	0.00%	NA
Indica III	913	38.20%	61.70%	0.00%	0.00%	CGCGGAAAACAA: 0.11%
Indica Intermediate	786	58.90%	40.50%	0.64%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	94.20%	5.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207329016	C -> CGCGGAAAACAA	LOC_Os12g13160.1	upstream_gene_variant ; 1356.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> CGCGGAAAACAA	LOC_Os12g13150.1	downstream_gene_variant ; 1492.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> CGCGGAAAACAA	LOC_Os12g13170.1	downstream_gene_variant ; 3054.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> CGCGGAAAACAA	LOC_Os12g13170.2	downstream_gene_variant ; 3054.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> CGCGGAAAACAA	LOC_Os12g13170.3	downstream_gene_variant ; 3055.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> CGCGGAAAACAA	LOC_Os12g13150-LOC_Os12g13160	intergenic_region ; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> T	LOC_Os12g13160.1	upstream_gene_variant ; 1357.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> T	LOC_Os12g13150.1	downstream_gene_variant ; 1491.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> T	LOC_Os12g13170.1	downstream_gene_variant ; 3055.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> T	LOC_Os12g13170.2	downstream_gene_variant ; 3055.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> T	LOC_Os12g13170.3	downstream_gene_variant ; 3056.0bp to feature; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N
vg1207329016	C -> T	LOC_Os12g13150-LOC_Os12g13160	intergenic_region ; MODIFIER	silent_mutation	Average:77.303; most accessible tissue: Callus, score: 89.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207329016	NA	5.28E-07	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207329016	NA	7.70E-06	mr1053_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207329016	NA	5.12E-06	mr1266_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251