\
| Variant ID: vg1207302951 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7302951 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACCACCAAATCATTTTTTTTGTTCCTGTAGAGTGGGTGTGCTACCTAGTTTGTTACCTGAAGTTGGCATGGAATTCAATACTGTTGATGAGGCTTGGAT[G/A]
TTTTGGGTTAGCTATGGTGGTCAAAAAGGTTTCGAGGTTAGAAAAAGGTACTCAAACAAAAGGAAATCAGATGGAAAGGTTAGGTCATGCAGATATGTTT
AAACATATCTGCATGACCTAACCTTTCCATCTGATTTCCTTTTGTTTGAGTACCTTTTTCTAACCTCGAAACCTTTTTGACCACCATAGCTAACCCAAAA[C/T]
ATCCAAGCCTCATCAACAGTATTGAATTCCATGCCAACTTCAGGTAACAAACTAGGTAGCACACCCACTCTACAGGAACAAAAAAAATGATTTGGTGGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 5.70% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 90.10% | 9.40% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 87.70% | 12.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 87.20% | 12.30% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 5.10% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207302951 | G -> A | LOC_Os12g13130.1 | upstream_gene_variant ; 3702.0bp to feature; MODIFIER | silent_mutation | Average:16.998; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| vg1207302951 | G -> A | LOC_Os12g13130.4 | upstream_gene_variant ; 3679.0bp to feature; MODIFIER | silent_mutation | Average:16.998; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| vg1207302951 | G -> A | LOC_Os12g13130.2 | upstream_gene_variant ; 3679.0bp to feature; MODIFIER | silent_mutation | Average:16.998; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| vg1207302951 | G -> A | LOC_Os12g13130.3 | upstream_gene_variant ; 3679.0bp to feature; MODIFIER | silent_mutation | Average:16.998; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| vg1207302951 | G -> A | LOC_Os12g13120.1 | downstream_gene_variant ; 4629.0bp to feature; MODIFIER | silent_mutation | Average:16.998; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| vg1207302951 | G -> A | LOC_Os12g13120.2 | downstream_gene_variant ; 1801.0bp to feature; MODIFIER | silent_mutation | Average:16.998; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| vg1207302951 | G -> A | LOC_Os12g13120-LOC_Os12g13130 | intergenic_region ; MODIFIER | silent_mutation | Average:16.998; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207302951 | 2.69E-06 | NA | mr1817 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207302951 | 1.65E-06 | 3.93E-06 | mr1817 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207302951 | NA | 1.95E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207302951 | NA | 7.77E-06 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |