\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207276357:

Variant ID: vg1207276357 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7276357
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ACATTTGCTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCGCAGTTTACTGATGGATTCTGTAATTAGTTTTTTTATTAGTGCTCGAACACCCCAT[G/A]
CGACACCCTATATAATACTTTATGTGACACGCCAAAACTTTACACCCGTGGATCTAAACACCCCCTATATATGCATTAATGCAAACCAAATTGATCAGAG

Reverse complement sequence

CTCTGATCAATTTGGTTTGCATTAATGCATATATAGGGGGTGTTTAGATCCACGGGTGTAAAGTTTTGGCGTGTCACATAAAGTATTATATAGGGTGTCG[C/T]
ATGGGGTGTTCGAGCACTAATAAAAAAACTAATTACAGAATCCATCAGTAAACTGCGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 11.30% 0.57% 1.04% NA
All Indica  2759 86.50% 11.10% 0.87% 1.59% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 34.20% 63.20% 0.74% 1.86% NA
Indica I  595 88.60% 9.10% 2.18% 0.17% NA
Indica II  465 90.50% 8.80% 0.22% 0.43% NA
Indica III  913 86.70% 10.20% 0.66% 2.41% NA
Indica Intermediate  786 82.20% 14.90% 0.51% 2.42% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207276357 G -> DEL N N silent_mutation Average:66.142; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg1207276357 G -> A LOC_Os12g13090.1 upstream_gene_variant ; 406.0bp to feature; MODIFIER silent_mutation Average:66.142; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg1207276357 G -> A LOC_Os12g13080-LOC_Os12g13090 intergenic_region ; MODIFIER silent_mutation Average:66.142; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207276357 G A 0.0 0.0 -0.01 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207276357 2.34E-06 9.51E-06 mr1062 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 1.80E-06 6.76E-07 mr1261 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 2.57E-06 9.30E-07 mr1324 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 7.11E-06 2.70E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 3.11E-06 3.11E-06 mr1429 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 2.00E-06 NA mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 NA 4.93E-06 mr1522 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 NA 7.60E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 2.09E-06 1.11E-06 mr1660 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 NA 7.21E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 NA 9.98E-06 mr1772 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207276357 NA 7.51E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251