\
| Variant ID: vg1207257056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7257056 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 213. )
GGAGGACTGCGAAAGTGAAAAGGAGGTGCAGAAACTAGAGCGCATGTTAGCGGACCACAAAACAGCGTTGTACCCAGGTTGCGAGAAGGGCTACAAAAAG[T/C]
TGAGTACCATCCTAGAATTCTTGCAATGGAAGGCTAAAAATGGTGTAAGTGACAAGGCATTCGGCGAGTTATTGAAACTCGTAAAGAACATTCTTCCGAA
TTCGGAAGAATGTTCTTTACGAGTTTCAATAACTCGCCGAATGCCTTGTCACTTACACCATTTTTAGCCTTCCATTGCAAGAATTCTAGGATGGTACTCA[A/G]
CTTTTTGTAGCCCTTCTCGCAACCTGGGTACAACGCTGTTTTGTGGTCCGCTAACATGCGCTCTAGTTTCTGCACCTCCTTTTCACTTTCGCAGTCCTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.10% | 11.20% | 0.72% | 0.00% | NA |
| All Indica | 2759 | 87.50% | 12.00% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 0.10% | 1.32% | 0.00% | NA |
| Aus | 269 | 47.20% | 52.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 9.60% | 0.84% | 0.00% | NA |
| Indica II | 465 | 90.30% | 9.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 88.60% | 11.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.10% | 16.40% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 0.10% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 50.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207257056 | T -> C | LOC_Os12g13070.1 | synonymous_variant ; p.Leu162Leu; LOW | synonymous_codon | Average:26.959; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207257056 | 6.92E-06 | 6.44E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207257056 | 1.62E-06 | 1.46E-08 | mr1347 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207257056 | NA | 6.39E-06 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207257056 | NA | 3.62E-08 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207257056 | NA | 3.57E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207257056 | NA | 4.78E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207257056 | 1.48E-06 | 1.29E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207257056 | 5.99E-07 | 8.25E-06 | mr1964 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |