Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207248243:

Variant ID: vg1207248243 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7248243
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAAAATAATTTTATAAAAGTATACATATATCACTTTTTAATAAATATTTTTATAGAAACAAGAAATCAAAGTTGTGTTTTGAAGACCATGTCGCTGTG[C/A]
AAAACGACTTTCTTTACGAGTACGGAGGGAGTACATGTTTCCTCACTTCTGCCTACTCGTTTTCCACGCTGCGTTCTTTTTTTTTTAGGGATTTTTTTTG

Reverse complement sequence

CAAAAAAAATCCCTAAAAAAAAAAGAACGCAGCGTGGAAAACGAGTAGGCAGAAGTGAGGAAACATGTACTCCCTCCGTACTCGTAAAGAAAGTCGTTTT[G/T]
CACAGCGACATGGTCTTCAAAACACAACTTTGATTTCTTGTTTCTATAAAAATATTTATTAAAAAGTGATATATGTATACTTTTATAAAATTATTTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	11.60%	0.06%	0.00%	NA
All Indica	2759	87.10%	12.80%	0.11%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	46.80%	53.20%	0.00%	0.00%	NA
Indica I	595	88.70%	10.90%	0.34%	0.00%	NA
Indica II	465	90.80%	9.20%	0.00%	0.00%	NA
Indica III	913	88.20%	11.80%	0.00%	0.00%	NA
Indica Intermediate	786	82.60%	17.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207248243	C -> A	LOC_Os12g13050.1	downstream_gene_variant ; 1677.0bp to feature; MODIFIER	silent_mutation	Average:34.765; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1207248243	C -> A	LOC_Os12g13060.1	downstream_gene_variant ; 2776.0bp to feature; MODIFIER	silent_mutation	Average:34.765; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1207248243	C -> A	LOC_Os12g13050-LOC_Os12g13060	intergenic_region ; MODIFIER	silent_mutation	Average:34.765; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207248243	7.54E-06	7.54E-06	mr1323	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	2.95E-06	6.67E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	6.69E-06	NA	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	1.05E-06	2.68E-06	mr1335	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	NA	2.50E-07	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	4.43E-06	4.43E-06	mr1452	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	4.41E-06	NA	mr1513	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	1.01E-06	1.68E-06	mr1590	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	9.51E-06	7.45E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	NA	7.44E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	NA	9.99E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	NA	4.61E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207248243	9.48E-07	NA	mr1964	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251