\
| Variant ID: vg1207220741 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7220741 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )
AATAGTTAATTTCCTTAATTCTGTCATGATCTGATGCAGCTTCCAAAATTCCCCAAGTCTGAAAGAGAGCTCAATGATACATCCATTCAGAACATTCAGG[C/T]
GGACATGTGCTACTTCATCCACCGTGAGTGCGCACATCAGCCTGGGCGGTTTTTCGACAACGAAGGAGTCTTAGCCCTGCCGGAGAACGAATCCCTGTCT
AGACAGGGATTCGTTCTCCGGCAGGGCTAAGACTCCTTCGTTGTCGAAAAACCGCCCAGGCTGATGTGCGCACTCACGGTGGATGAAGTAGCACATGTCC[G/A]
CCTGAATGTTCTGAATGGATGTATCATTGAGCTCTCTTTCAGACTTGGGGAATTTTGGAAGCTGCATCAGATCATGACAGAATTAAGGAAATTAACTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 11.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 87.00% | 12.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 46.80% | 53.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.20% | 11.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207220741 | C -> T | LOC_Os12g13020.1 | missense_variant ; p.Ala852Val; MODERATE | nonsynonymous_codon ; A852V | Average:17.82; most accessible tissue: Minghui63 young leaf, score: 23.613 | benign |
0.181 |
TOLERATED | 0.48 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207220741 | 3.20E-06 | 7.95E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 6.53E-06 | NA | mr1335 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 2.10E-06 | 4.55E-06 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | NA | 2.95E-07 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 9.83E-06 | 8.89E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 2.70E-06 | 2.53E-06 | mr1590 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 6.01E-06 | NA | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 5.03E-06 | NA | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | NA | 6.79E-07 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 4.57E-07 | 4.40E-09 | mr1815 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 4.94E-06 | NA | mr1815 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207220741 | 8.74E-07 | 9.95E-06 | mr1964 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |