Variant ID: vg1207208550 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 7208550 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.15, A: 0.02, others allele: 0.00, population size: 101. )
ATATAAATCACACTTAAAGTACTATGAATGATAAAATAACTCATAACAAAATAAATAATAATTACGTAAATTTTTTGAATAATACGAATGGTCAAACATG[T/C]
GAGAAAAAGTCAACGGCATCATCTATTATAAAACAGAGGGAGTACCTGTTACTACCACACTCACAAATCGCAAATGCGTAAACGTCTCCTAACACACGCT
AGCGTGTGTTAGGAGACGTTTACGCATTTGCGATTTGTGAGTGTGGTAGTAACAGGTACTCCCTCTGTTTTATAATAGATGATGCCGTTGACTTTTTCTC[A/G]
CATGTTTGACCATTCGTATTATTCAAAAAATTTACGTAATTATTATTTATTTTGTTATGAGTTATTTTATCATTCATAGTACTTTAAGTGTGATTTATAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 49.00% | 48.60% | 1.59% | 0.87% | NA |
All Indica | 2759 | 78.70% | 17.20% | 2.61% | 1.49% | NA |
All Japonica | 1512 | 5.10% | 94.80% | 0.13% | 0.00% | NA |
Aus | 269 | 14.50% | 85.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 72.40% | 14.60% | 7.73% | 5.21% | NA |
Indica II | 465 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
Indica III | 913 | 84.60% | 14.90% | 0.33% | 0.22% | NA |
Indica Intermediate | 786 | 71.90% | 24.20% | 2.93% | 1.02% | NA |
Temperate Japonica | 767 | 5.10% | 94.70% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
Intermediate | 90 | 26.70% | 72.20% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1207208550 | T -> C | LOC_Os12g13010.1 | upstream_gene_variant ; 1834.0bp to feature; MODIFIER | silent_mutation | Average:49.759; most accessible tissue: Callus, score: 71.635 | N | N | N | N |
vg1207208550 | T -> C | LOC_Os12g13000-LOC_Os12g13010 | intergenic_region ; MODIFIER | silent_mutation | Average:49.759; most accessible tissue: Callus, score: 71.635 | N | N | N | N |
vg1207208550 | T -> DEL | N | N | silent_mutation | Average:49.759; most accessible tissue: Callus, score: 71.635 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1207208550 | NA | 3.41E-10 | mr1174 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207208550 | NA | 2.21E-06 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207208550 | NA | 5.68E-06 | mr1582 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207208550 | NA | 4.82E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207208550 | NA | 7.74E-07 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207208550 | NA | 3.97E-06 | mr1772 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207208550 | NA | 1.97E-06 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |