\
| Variant ID: vg1207192862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7192862 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 94. )
TAATCATCTAAAAGCTAAAAACAACTGATGTGATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTCGGACCAAAATCATTTAAGCACTAAGTGAG[G/A]
ATGAACAATATAAGTATATAGGATATCATAAAAACATAAAAAGATATACATTGAAACATTATGTAAATTATATTGGATGATAATTTAACATGTTTGTATT
AATACAAACATGTTAAATTATCATCCAATATAATTTACATAATGTTTCAATGTATATCTTTTTATGTTTTTATGATATCCTATATACTTATATTGTTCAT[C/T]
CTCACTTAGTGCTTAAATGATTTTGGTCCGAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATATCACATCAGTTGTTTTTAGCTTTTAGATGATTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 41.30% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 89.50% | 10.30% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 2.90% | 97.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.70% | 14.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 91.60% | 8.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.80% | 12.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.00% | 93.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 26.70% | 73.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207192862 | G -> A | LOC_Os12g12970.1 | upstream_gene_variant ; 4700.0bp to feature; MODIFIER | silent_mutation | Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1207192862 | G -> A | LOC_Os12g12990.1 | upstream_gene_variant ; 1054.0bp to feature; MODIFIER | silent_mutation | Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1207192862 | G -> A | LOC_Os12g12980.1 | downstream_gene_variant ; 2029.0bp to feature; MODIFIER | silent_mutation | Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1207192862 | G -> A | LOC_Os12g12980-LOC_Os12g12990 | intergenic_region ; MODIFIER | silent_mutation | Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207192862 | NA | 3.07E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | 1.89E-06 | 1.89E-06 | mr1025 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 4.23E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 5.18E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 3.43E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 7.00E-14 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 2.03E-10 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 1.60E-07 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 1.49E-10 | mr1804 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 1.37E-06 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207192862 | NA | 8.80E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |