\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207192862:

Variant ID: vg1207192862 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7192862
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TAATCATCTAAAAGCTAAAAACAACTGATGTGATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTCGGACCAAAATCATTTAAGCACTAAGTGAG[G/A]
ATGAACAATATAAGTATATAGGATATCATAAAAACATAAAAAGATATACATTGAAACATTATGTAAATTATATTGGATGATAATTTAACATGTTTGTATT

Reverse complement sequence

AATACAAACATGTTAAATTATCATCCAATATAATTTACATAATGTTTCAATGTATATCTTTTTATGTTTTTATGATATCCTATATACTTATATTGTTCAT[C/T]
CTCACTTAGTGCTTAAATGATTTTGGTCCGAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATATCACATCAGTTGTTTTTAGCTTTTAGATGATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 41.30% 0.15% 0.00% NA
All Indica  2759 89.50% 10.30% 0.22% 0.00% NA
All Japonica  1512 2.90% 97.00% 0.07% 0.00% NA
Aus  269 67.30% 32.70% 0.00% 0.00% NA
Indica I  595 84.70% 14.80% 0.50% 0.00% NA
Indica II  465 91.60% 8.20% 0.22% 0.00% NA
Indica III  913 93.00% 7.00% 0.00% 0.00% NA
Indica Intermediate  786 87.80% 12.00% 0.25% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 6.00% 93.80% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 26.70% 73.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207192862 G -> A LOC_Os12g12970.1 upstream_gene_variant ; 4700.0bp to feature; MODIFIER silent_mutation Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1207192862 G -> A LOC_Os12g12990.1 upstream_gene_variant ; 1054.0bp to feature; MODIFIER silent_mutation Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1207192862 G -> A LOC_Os12g12980.1 downstream_gene_variant ; 2029.0bp to feature; MODIFIER silent_mutation Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1207192862 G -> A LOC_Os12g12980-LOC_Os12g12990 intergenic_region ; MODIFIER silent_mutation Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207192862 NA 3.07E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 1.89E-06 1.89E-06 mr1025 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 4.23E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 5.18E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 3.43E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 7.00E-14 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 2.03E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 1.60E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 1.49E-10 mr1804 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 1.37E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862 NA 8.80E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251