| Variant ID: vg1207186403 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7186403 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )
ATTTGATAAATTTTAACATAGGAAAAAGTTAAATCAACTTACAATACAAATATATAATATAACTAGCTAAATGTCTGTGCTTAATTTGCTATGGATAAAA[G/T]
AAAAATCACAATATTTTCTAAAATAAATAAAACACATTTTCCATAAAAATATGTTATCCACATTTTTTGGAAAATGTGGCTACCAACATTAATTTTATAT
ATATAAAATTAATGTTGGTAGCCACATTTTCCAAAAAATGTGGATAACATATTTTTATGGAAAATGTGTTTTATTTATTTTAGAAAATATTGTGATTTTT[C/A]
TTTTATCCATAGCAAATTAAGCACAGACATTTAGCTAGTTATATTATATATTTGTATTGTAAGTTGATTTAACTTTTTCCTATGTTAAAATTTATCAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.10% | 9.20% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 83.30% | 15.50% | 1.27% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 49.20% | 46.40% | 4.37% | 0.00% | NA |
| Indica II | 465 | 86.70% | 12.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.70% | 11.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207186403 | G -> T | LOC_Os12g12980.1 | upstream_gene_variant ; 3881.0bp to feature; MODIFIER | silent_mutation | Average:26.302; most accessible tissue: Callus, score: 37.477 | N | N | N | N |
| vg1207186403 | G -> T | LOC_Os12g12970.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.302; most accessible tissue: Callus, score: 37.477 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207186403 | NA | 5.62E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1207186403 | 3.22E-07 | 3.22E-07 | mr1521 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207186403 | NA | 7.10E-08 | mr1864 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207186403 | NA | 9.77E-07 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207186403 | NA | 7.39E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207186403 | NA | 2.90E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207186403 | NA | 9.10E-06 | mr1521_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |