\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207186403:

Variant ID: vg1207186403 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7186403
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGATAAATTTTAACATAGGAAAAAGTTAAATCAACTTACAATACAAATATATAATATAACTAGCTAAATGTCTGTGCTTAATTTGCTATGGATAAAA[G/T]
AAAAATCACAATATTTTCTAAAATAAATAAAACACATTTTCCATAAAAATATGTTATCCACATTTTTTGGAAAATGTGGCTACCAACATTAATTTTATAT

Reverse complement sequence

ATATAAAATTAATGTTGGTAGCCACATTTTCCAAAAAATGTGGATAACATATTTTTATGGAAAATGTGTTTTATTTATTTTAGAAAATATTGTGATTTTT[C/A]
TTTTATCCATAGCAAATTAAGCACAGACATTTAGCTAGTTATATTATATATTTGTATTGTAAGTTGATTTAACTTTTTCCTATGTTAAAATTTATCAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 9.20% 0.74% 0.00% NA
All Indica  2759 83.30% 15.50% 1.27% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 49.20% 46.40% 4.37% 0.00% NA
Indica II  465 86.70% 12.50% 0.86% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 87.70% 11.80% 0.51% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207186403 G -> T LOC_Os12g12980.1 upstream_gene_variant ; 3881.0bp to feature; MODIFIER silent_mutation Average:26.302; most accessible tissue: Callus, score: 37.477 N N N N
vg1207186403 G -> T LOC_Os12g12970.1 intron_variant ; MODIFIER silent_mutation Average:26.302; most accessible tissue: Callus, score: 37.477 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207186403 NA 5.62E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207186403 3.22E-07 3.22E-07 mr1521 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207186403 NA 7.10E-08 mr1864 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207186403 NA 9.77E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207186403 NA 7.39E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207186403 NA 2.90E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207186403 NA 9.10E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251