Variant ID: vg1207172574 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 7172574 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 322. )
AATAAACAATAGTAATCAGATATAAGGAGAATTGCTCATTAAGTAACAAGATGAATTCTTCGAAGAGTAAATTGGCATCCAAAAAGTCATTCCCCATTCC[C/T]
CTTGTTCCAACAAAAGAAGTACAACTAATAAGCAACATATTATTTTGCATCCTACAAATTATGTATTATATCAACACAGATATTTCATACGCATATGATA
TATCATATGCGTATGAAATATCTGTGTTGATATAATACATAATTTGTAGGATGCAAAATAATATGTTGCTTATTAGTTGTACTTCTTTTGTTGGAACAAG[G/A]
GGAATGGGGAATGACTTTTTGGATGCCAATTTACTCTTCGAAGAATTCATCTTGTTACTTAATGAGCAATTCTCCTTATATCTGATTACTATTGTTTATT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.50% | 7.50% | 0.06% | 0.00% | NA |
All Indica | 2759 | 87.40% | 12.50% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 57.80% | 41.90% | 0.22% | 0.00% | NA |
Indica III | 913 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 85.20% | 14.60% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1207172574 | C -> T | LOC_Os12g12960.1 | upstream_gene_variant ; 4502.0bp to feature; MODIFIER | silent_mutation | Average:59.317; most accessible tissue: Callus, score: 84.44 | N | N | N | N |
vg1207172574 | C -> T | LOC_Os12g12934.1 | downstream_gene_variant ; 1548.0bp to feature; MODIFIER | silent_mutation | Average:59.317; most accessible tissue: Callus, score: 84.44 | N | N | N | N |
vg1207172574 | C -> T | LOC_Os12g12950.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.317; most accessible tissue: Callus, score: 84.44 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1207172574 | NA | 1.60E-06 | mr1024 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207172574 | NA | 5.77E-11 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207172574 | NA | 9.42E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207172574 | 3.15E-06 | NA | mr1024_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207172574 | 8.66E-06 | 8.80E-11 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207172574 | 2.10E-06 | 1.00E-17 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207172574 | NA | 1.03E-13 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207172574 | NA | 2.10E-06 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |