Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207172574:

Variant ID: vg1207172574 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7172574
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

AATAAACAATAGTAATCAGATATAAGGAGAATTGCTCATTAAGTAACAAGATGAATTCTTCGAAGAGTAAATTGGCATCCAAAAAGTCATTCCCCATTCC[C/T]
CTTGTTCCAACAAAAGAAGTACAACTAATAAGCAACATATTATTTTGCATCCTACAAATTATGTATTATATCAACACAGATATTTCATACGCATATGATA

Reverse complement sequence

TATCATATGCGTATGAAATATCTGTGTTGATATAATACATAATTTGTAGGATGCAAAATAATATGTTGCTTATTAGTTGTACTTCTTTTGTTGGAACAAG[G/A]
GGAATGGGGAATGACTTTTTGGATGCCAATTTACTCTTCGAAGAATTCATCTTGTTACTTAATGAGCAATTCTCCTTATATCTGATTACTATTGTTTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	7.50%	0.06%	0.00%	NA
All Indica	2759	87.40%	12.50%	0.07%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	57.80%	41.90%	0.22%	0.00%	NA
Indica III	913	96.50%	3.50%	0.00%	0.00%	NA
Indica Intermediate	786	85.20%	14.60%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207172574	C -> T	LOC_Os12g12960.1	upstream_gene_variant ; 4502.0bp to feature; MODIFIER	silent_mutation	Average:59.317; most accessible tissue: Callus, score: 84.44	N	N	N	N
vg1207172574	C -> T	LOC_Os12g12934.1	downstream_gene_variant ; 1548.0bp to feature; MODIFIER	silent_mutation	Average:59.317; most accessible tissue: Callus, score: 84.44	N	N	N	N
vg1207172574	C -> T	LOC_Os12g12950.1	intron_variant ; MODIFIER	silent_mutation	Average:59.317; most accessible tissue: Callus, score: 84.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207172574	NA	1.60E-06	mr1024	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574	NA	5.77E-11	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574	NA	9.42E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574	3.15E-06	NA	mr1024_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574	8.66E-06	8.80E-11	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574	2.10E-06	1.00E-17	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574	NA	1.03E-13	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574	NA	2.10E-06	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251