\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207172574:

Variant ID: vg1207172574 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7172574
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


AATAAACAATAGTAATCAGATATAAGGAGAATTGCTCATTAAGTAACAAGATGAATTCTTCGAAGAGTAAATTGGCATCCAAAAAGTCATTCCCCATTCC[C/T]
CTTGTTCCAACAAAAGAAGTACAACTAATAAGCAACATATTATTTTGCATCCTACAAATTATGTATTATATCAACACAGATATTTCATACGCATATGATA

Reverse complement sequence

TATCATATGCGTATGAAATATCTGTGTTGATATAATACATAATTTGTAGGATGCAAAATAATATGTTGCTTATTAGTTGTACTTCTTTTGTTGGAACAAG[G/A]
GGAATGGGGAATGACTTTTTGGATGCCAATTTACTCTTCGAAGAATTCATCTTGTTACTTAATGAGCAATTCTCCTTATATCTGATTACTATTGTTTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.50% 0.06% 0.00% NA
All Indica  2759 87.40% 12.50% 0.07% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 57.80% 41.90% 0.22% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 85.20% 14.60% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207172574 C -> T LOC_Os12g12960.1 upstream_gene_variant ; 4502.0bp to feature; MODIFIER silent_mutation Average:59.317; most accessible tissue: Callus, score: 84.44 N N N N
vg1207172574 C -> T LOC_Os12g12934.1 downstream_gene_variant ; 1548.0bp to feature; MODIFIER silent_mutation Average:59.317; most accessible tissue: Callus, score: 84.44 N N N N
vg1207172574 C -> T LOC_Os12g12950.1 intron_variant ; MODIFIER silent_mutation Average:59.317; most accessible tissue: Callus, score: 84.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207172574 NA 1.60E-06 mr1024 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574 NA 5.77E-11 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574 NA 9.42E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574 3.15E-06 NA mr1024_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574 8.66E-06 8.80E-11 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574 2.10E-06 1.00E-17 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574 NA 1.03E-13 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207172574 NA 2.10E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251