\
| Variant ID: vg1207114214 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7114214 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )
CCTCTCAGTGTGCTTCAAACCTGGTACAAAATATAGCTATTTCATATAGTTCAATCCACATATACCATATATCAACAAATATTTAAGTATCGATCATGCA[C/T]
GATTCTTCCCCATTAGGTGCAAGATTCAATGAGATTGTTGGATCTCCCTACTACATGGCACCAGAAGTCCTGAAGAGAAACTATGGACAAGAAATAGACA
TGTCTATTTCTTGTCCATAGTTTCTCTTCAGGACTTCTGGTGCCATGTAGTAGGGAGATCCAACAATCTCATTGAATCTTGCACCTAATGGGGAAGAATC[G/A]
TGCATGATCGATACTTAAATATTTGTTGATATATGGTATATGTGGATTGAACTATATGAAATAGCTATATTTTGTACCAGGTTTGAAGCACACTGAGAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 19.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 68.00% | 32.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 48.60% | 51.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 44.70% | 55.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.90% | 6.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207114214 | C -> T | LOC_Os12g12860.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.147; most accessible tissue: Callus, score: 87.544 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207114214 | NA | 6.53E-06 | mr1177 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | NA | 7.18E-07 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | NA | 2.80E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | 6.44E-07 | 4.81E-10 | mr1024_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | NA | 5.78E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | NA | 2.62E-17 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | NA | 3.92E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | NA | 8.07E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | NA | 2.72E-09 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207114214 | NA | 1.78E-07 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |