\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207110670:

Variant ID: vg1207110670 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7110670
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTATATCATCATAGATCTAGGGACAAGGCCATCAACGCTAGGAACATTAAGGGCATGTTTGGTAGAGTTCCAACTCCTAAATTTAGTTATAGGAGTTG[G/T]
ATCTGGAGTGAAGTTGTAGAGTTGTATAAACCCAGCTCCATCTTTCTAGTTCATTTTATGAGAGCACTTCTATCAGTTCCGTTCTAATTTTTAGTGGAGC

Reverse complement sequence

GCTCCACTAAAAATTAGAACGGAACTGATAGAAGTGCTCTCATAAAATGAACTAGAAAGATGGAGCTGGGTTTATACAACTCTACAACTTCACTCCAGAT[C/A]
CAACTCCTATAACTAAATTTAGGAGTTGGAACTCTACCAAACATGCCCTTAATGTTCCTAGCGTTGATGGCCTTGTCCCTAGATCTATGATGATATAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 19.10% 0.04% 0.00% NA
All Indica  2759 68.00% 32.00% 0.07% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 48.40% 51.40% 0.17% 0.00% NA
Indica II  465 44.70% 55.30% 0.00% 0.00% NA
Indica III  913 93.90% 6.00% 0.11% 0.00% NA
Indica Intermediate  786 66.40% 33.60% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207110670 G -> T LOC_Os12g12854.1 upstream_gene_variant ; 4273.0bp to feature; MODIFIER silent_mutation Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg1207110670 G -> T LOC_Os12g12860.1 upstream_gene_variant ; 1616.0bp to feature; MODIFIER silent_mutation Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg1207110670 G -> T LOC_Os12g12854-LOC_Os12g12860 intergenic_region ; MODIFIER silent_mutation Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207110670 NA 1.76E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 NA 1.59E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 NA 6.13E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 NA 3.08E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 1.41E-06 4.21E-10 mr1024_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 NA 1.90E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 NA 2.70E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 NA 5.58E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 NA 1.23E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670 NA 1.25E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251