\
| Variant ID: vg1207110670 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7110670 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 88. )
GCCTATATCATCATAGATCTAGGGACAAGGCCATCAACGCTAGGAACATTAAGGGCATGTTTGGTAGAGTTCCAACTCCTAAATTTAGTTATAGGAGTTG[G/T]
ATCTGGAGTGAAGTTGTAGAGTTGTATAAACCCAGCTCCATCTTTCTAGTTCATTTTATGAGAGCACTTCTATCAGTTCCGTTCTAATTTTTAGTGGAGC
GCTCCACTAAAAATTAGAACGGAACTGATAGAAGTGCTCTCATAAAATGAACTAGAAAGATGGAGCTGGGTTTATACAACTCTACAACTTCACTCCAGAT[C/A]
CAACTCCTATAACTAAATTTAGGAGTTGGAACTCTACCAAACATGCCCTTAATGTTCCTAGCGTTGATGGCCTTGTCCCTAGATCTATGATGATATAGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 19.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 68.00% | 32.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 48.40% | 51.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 44.70% | 55.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.90% | 6.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207110670 | G -> T | LOC_Os12g12854.1 | upstream_gene_variant ; 4273.0bp to feature; MODIFIER | silent_mutation | Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536 | N | N | N | N |
| vg1207110670 | G -> T | LOC_Os12g12860.1 | upstream_gene_variant ; 1616.0bp to feature; MODIFIER | silent_mutation | Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536 | N | N | N | N |
| vg1207110670 | G -> T | LOC_Os12g12854-LOC_Os12g12860 | intergenic_region ; MODIFIER | silent_mutation | Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207110670 | NA | 1.76E-06 | mr1177 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | NA | 1.59E-07 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | NA | 6.13E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | NA | 3.08E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | 1.41E-06 | 4.21E-10 | mr1024_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | NA | 1.90E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | NA | 2.70E-17 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | NA | 5.58E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | NA | 1.23E-08 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207110670 | NA | 1.25E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |