\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207090120:

Variant ID: vg1207090120 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7090120
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, C: 0.19, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


CGAATCTGATTCTGTATGCCTGAATCATATAATACTGGATATCTCGACCTGGATTTTTTACATTTTGGTCCTTTTAAAAAACTTATTTCATAAATAGACC[T/C]
CTGAAAAAACTTATCCCAGAAATGGTCCTTTTTAGGGCGCCAGAGTGGCTGGCGCCGTCATCCAACGGGACGGCGCCAGCCTCCTGCCACCGTGGCGCAC

Reverse complement sequence

GTGCGCCACGGTGGCAGGAGGCTGGCGCCGTCCCGTTGGATGACGGCGCCAGCCACTCTGGCGCCCTAAAAAGGACCATTTCTGGGATAAGTTTTTTCAG[A/G]
GGTCTATTTATGAAATAAGTTTTTTAAAAGGACCAAAATGTAAAAAATCCAGGTCGAGATATCCAGTATTATATGATTCAGGCATACAGAATCAGATTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 11.60% 0.70% 23.83% NA
All Indica  2759 82.10% 16.20% 0.18% 1.49% NA
All Japonica  1512 31.00% 5.00% 0.53% 63.49% NA
Aus  269 65.40% 7.10% 0.00% 27.51% NA
Indica I  595 71.80% 27.20% 0.00% 1.01% NA
Indica II  465 94.20% 3.40% 0.43% 1.94% NA
Indica III  913 82.90% 15.90% 0.33% 0.88% NA
Indica Intermediate  786 81.90% 15.80% 0.00% 2.29% NA
Temperate Japonica  767 30.90% 9.10% 0.52% 59.45% NA
Tropical Japonica  504 20.20% 0.40% 0.60% 78.77% NA
Japonica Intermediate  241 53.50% 1.70% 0.41% 44.40% NA
VI/Aromatic  96 62.50% 1.00% 17.71% 18.75% NA
Intermediate  90 53.30% 6.70% 3.33% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207090120 T -> C LOC_Os12g12840-LOC_Os12g12850 intergenic_region ; MODIFIER silent_mutation Average:91.72; most accessible tissue: Minghui63 young leaf, score: 95.967 N N N N
vg1207090120 T -> DEL N N silent_mutation Average:91.72; most accessible tissue: Minghui63 young leaf, score: 95.967 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207090120 T C 0.04 0.05 0.04 0.03 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207090120 NA 5.39E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207090120 NA 3.60E-07 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 6.80E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 2.07E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 1.79E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 3.53E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 2.33E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 7.52E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 2.65E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 7.69E-06 mr1460_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 2.52E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 6.21E-07 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 2.41E-06 2.41E-06 mr1605_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 4.42E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 5.43E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 5.83E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 7.85E-06 7.86E-06 mr1787_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 2.25E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 3.55E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 3.25E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207090120 NA 2.26E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251