Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1207088649:

Variant ID: vg1207088649 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7088649
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTACACTAATTAATCCCTATGTATATAGGTTCTATATACAAATTACTATACACCAATTGCCAAGCCATATTGCTTACATGACATCCATGCACAGAGTG[T/C]
GTCCTGATATCCAATGAACATGTTTGTCATGAAGCACGATAAAGGACGATACTAAGTAGGCAATTATCAACAAATGATACGTAAATAGAGGATACCACCA

Reverse complement sequence

TGGTGGTATCCTCTATTTACGTATCATTTGTTGATAATTGCCTACTTAGTATCGTCCTTTATCGTGCTTCATGACAAACATGTTCATTGGATATCAGGAC[A/G]
CACTCTGTGCATGGATGTCATGTAAGCAATATGGCTTGGCAATTGGTGTATAGTAATTTGTATATAGAACCTATATACATAGGGATTAATTAGTGTAGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	4.80%	4.02%	14.81%	NA
All Indica	2759	98.40%	0.40%	0.14%	1.01%	NA
All Japonica	1512	37.10%	11.90%	11.51%	39.48%	NA
Aus	269	73.60%	10.40%	2.97%	13.01%	NA
Indica I	595	99.00%	0.20%	0.17%	0.67%	NA
Indica II	465	98.10%	0.40%	0.00%	1.51%	NA
Indica III	913	99.10%	0.30%	0.11%	0.44%	NA
Indica Intermediate	786	97.30%	0.80%	0.25%	1.65%	NA
Temperate Japonica	767	41.50%	1.20%	3.00%	54.37%	NA
Tropical Japonica	504	21.20%	30.40%	28.17%	20.24%	NA
Japonica Intermediate	241	56.40%	7.50%	3.73%	32.37%	NA
VI/Aromatic	96	81.20%	0.00%	0.00%	18.75%	NA
Intermediate	90	64.40%	6.70%	4.44%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207088649	T -> C	LOC_Os12g12840-LOC_Os12g12850	intergenic_region ; MODIFIER	silent_mutation	Average:42.411; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1207088649	T -> DEL	N	N	silent_mutation	Average:42.411; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207088649	7.69E-06	NA	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	7.53E-07	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	1.80E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	7.92E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	2.77E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	3.08E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	9.88E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	7.70E-06	mr1633	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	1.13E-06	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	7.18E-08	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	1.27E-07	7.11E-06	mr1906	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	1.46E-06	NA	mr1909	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	2.57E-08	4.75E-06	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	3.53E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207088649	NA	1.46E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251