\
| Variant ID: vg1207088249 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7088249 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 112. )
CTCTATTCATACGTTATTGGTAAATTAAAGATCTAAAATATTCTTTTGACACCATATTGATGTTCTTTATCTCCTACTTAGCCTTCATTCCATCTAGCTC[A/T]
TTCATTGAGGTCACATGAAAAGATGCACTTCAATAGCGCAAGATTAATTAATTATTAAATATTACAAACTCAAAAGTGAATTTATTTGATTTTTATAAAA
TTTTATAAAAATCAAATAAATTCACTTTTGAGTTTGTAATATTTAATAATTAATTAATCTTGCGCTATTGAAGTGCATCTTTTCATGTGACCTCAATGAA[T/A]
GAGCTAGATGGAATGAAGGCTAAGTAGGAGATAAAGAACATCAATATGGTGTCAAAAGAATATTTTAGATCTTTAATTTACCAATAACGTATGAATAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.00% | 9.30% | 1.86% | 13.90% | NA |
| All Indica | 2759 | 97.00% | 1.00% | 1.09% | 0.91% | NA |
| All Japonica | 1512 | 36.60% | 23.80% | 1.79% | 37.83% | NA |
| Aus | 269 | 67.70% | 15.20% | 5.95% | 11.15% | NA |
| Indica I | 595 | 99.20% | 0.20% | 0.17% | 0.50% | NA |
| Indica II | 465 | 93.30% | 1.30% | 4.09% | 1.29% | NA |
| Indica III | 913 | 97.90% | 1.00% | 0.66% | 0.44% | NA |
| Indica Intermediate | 786 | 96.60% | 1.40% | 0.51% | 1.53% | NA |
| Temperate Japonica | 767 | 41.20% | 2.60% | 2.09% | 54.11% | NA |
| Tropical Japonica | 504 | 20.40% | 61.90% | 1.59% | 16.07% | NA |
| Japonica Intermediate | 241 | 55.60% | 11.60% | 1.24% | 31.54% | NA |
| VI/Aromatic | 96 | 79.20% | 1.00% | 9.38% | 10.42% | NA |
| Intermediate | 90 | 61.10% | 10.00% | 6.67% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207088249 | A -> DEL | N | N | silent_mutation | Average:27.968; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1207088249 | A -> T | LOC_Os12g12840-LOC_Os12g12850 | intergenic_region ; MODIFIER | silent_mutation | Average:27.968; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207088249 | 1.09E-06 | NA | mr1236 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 2.25E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 1.26E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 3.30E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 2.45E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 2.77E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 1.98E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 9.72E-06 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 2.57E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 7.06E-06 | mr1633 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 4.77E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | NA | 7.11E-08 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207088249 | 1.17E-06 | NA | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |