\
| Variant ID: vg1207087743 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7087743 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGGAAAAAATTTAATCCTTAATGTCAATTTAAATCGGTAGATCCATAATATTAAACCGATGAACCCATTAAATCCACATATATGCACCACTGACTTTTG[C/G]
CATTTGTGTGACAACCAAATAACAACGAAACAACATAGTAATAAATAATAACACACATATAAGTTGGATATTATGCTTTAAGGTGTAAAAACATACTGCA
TGCAGTATGTTTTTACACCTTAAAGCATAATATCCAACTTATATGTGTGTTATTATTTATTACTATGTTGTTTCGTTGTTATTTGGTTGTCACACAAATG[G/C]
CAAAAGTCAGTGGTGCATATATGTGGATTTAATGGGTTCATCGGTTTAATATTATGGATCTACCGATTTAAATTGACATTAAGGATTAAATTTTTTCCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.20% | 8.10% | 1.18% | 14.54% | NA |
| All Indica | 2759 | 98.40% | 0.50% | 0.14% | 1.01% | NA |
| All Japonica | 1512 | 36.40% | 23.30% | 1.39% | 38.82% | NA |
| Aus | 269 | 73.60% | 3.00% | 11.15% | 12.27% | NA |
| Indica I | 595 | 99.00% | 0.20% | 0.17% | 0.67% | NA |
| Indica II | 465 | 98.10% | 0.40% | 0.00% | 1.51% | NA |
| Indica III | 913 | 99.00% | 0.40% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 97.30% | 0.80% | 0.25% | 1.65% | NA |
| Temperate Japonica | 767 | 40.70% | 2.50% | 1.56% | 55.28% | NA |
| Tropical Japonica | 504 | 20.60% | 60.70% | 1.59% | 17.06% | NA |
| Japonica Intermediate | 241 | 56.00% | 11.60% | 0.41% | 31.95% | NA |
| VI/Aromatic | 96 | 81.20% | 0.00% | 1.04% | 17.71% | NA |
| Intermediate | 90 | 65.60% | 10.00% | 0.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207087743 | C -> DEL | N | N | silent_mutation | Average:28.923; most accessible tissue: Minghui63 flower, score: 45.483 | N | N | N | N |
| vg1207087743 | C -> G | LOC_Os12g12840-LOC_Os12g12850 | intergenic_region ; MODIFIER | silent_mutation | Average:28.923; most accessible tissue: Minghui63 flower, score: 45.483 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207087743 | 4.72E-07 | NA | mr1236 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 7.53E-07 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 1.38E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 7.92E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 3.22E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 3.08E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 9.88E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 7.70E-06 | mr1633 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 1.13E-06 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 3.19E-06 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 7.17E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | 5.83E-06 | NA | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | 7.65E-07 | NA | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 3.53E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087743 | NA | 1.46E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |