\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207087505:

Variant ID: vg1207087505 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7087505
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.01, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTTTTTCTTTTTTCTTTCCTATTTAGATTAGATGAAAAGTAGCATACTAATCCCTCCGAACACCCCATGCACGCACATAGGCACGTACGTACACAT[T/C]
CTCCATCCTCCAATAAACCTCTCTCTCACCTTCCTATTTTCTAGCTAATAATTTAATTTTTAAAAAATATTATAAAGGAAAATTTTAATCCTTCCTATAT

Reverse complement sequence

ATATAGGAAGGATTAAAATTTTCCTTTATAATATTTTTTAAAAATTAAATTATTAGCTAGAAAATAGGAAGGTGAGAGAGAGGTTTATTGGAGGATGGAG[A/G]
ATGTGTACGTACGTGCCTATGTGCGTGCATGGGGTGTTCGGAGGGATTAGTATGCTACTTTTCATCTAATCTAAATAGGAAAGAAAAAAGAAAAAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 9.00% 1.65% 17.69% NA
All Indica  2759 93.10% 0.60% 1.34% 4.97% NA
All Japonica  1512 33.50% 23.70% 2.12% 40.67% NA
Aus  269 68.00% 14.50% 0.74% 16.73% NA
Indica I  595 98.00% 0.20% 0.50% 1.34% NA
Indica II  465 90.10% 0.60% 0.86% 8.39% NA
Indica III  913 91.30% 0.50% 2.30% 5.81% NA
Indica Intermediate  786 93.10% 1.00% 1.15% 4.71% NA
Temperate Japonica  767 39.50% 2.70% 2.09% 55.67% NA
Tropical Japonica  504 15.70% 61.30% 2.18% 20.83% NA
Japonica Intermediate  241 51.90% 11.60% 2.07% 34.44% NA
VI/Aromatic  96 79.20% 0.00% 2.08% 18.75% NA
Intermediate  90 60.00% 11.10% 5.56% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207087505 T -> C LOC_Os12g12840-LOC_Os12g12850 intergenic_region ; MODIFIER silent_mutation Average:54.424; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N
vg1207087505 T -> DEL N N silent_mutation Average:54.424; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207087505 3.88E-06 NA mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 7.53E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 2.81E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 7.92E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 6.54E-06 1.06E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 3.08E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 9.88E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 7.70E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 5.16E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 1.13E-06 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 1.46E-07 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 9.68E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 3.47E-07 NA mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 2.14E-08 9.28E-06 mr1960 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 3.53E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207087505 NA 1.46E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251