\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207053263:

Variant ID: vg1207053263 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7053263
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGACGCAAGAACGACAAGTCGAAGACAGGGGGAGAGAAGAAACTAGCCAAGGACGCACCTGAATCAAGCAAGAAGAAAAGTCGCAAGAGTGGGAAAAG[G/A,C]
AAAGCTCAAGTGGAAGTCCTCGCGACAGAATACGAGCACCCTCCCAAGCACCCAGACCCACAAGGCAGCGACACGAAGAAAATATGGTGCCCTATACACA

Reverse complement sequence

TGTGTATAGGGCACCATATTTTCTTCGTGTCGCTGCCTTGTGGGTCTGGGTGCTTGGGAGGGTGCTCGTATTCTGTCGCGAGGACTTCCACTTGAGCTTT[C/T,G]
CTTTTCCCACTCTTGCGACTTTTCTTCTTGCTTGATTCAGGTGCGTCCTTGGCTAGTTTCTTCTCTCCCCCTGTCTTCGACTTGTCGTTCTTGCGTCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 9.20% 1.12% 8.29% C: 0.13%
All Indica  2759 85.10% 13.60% 0.72% 0.47% C: 0.14%
All Japonica  1512 69.70% 3.50% 2.12% 24.67% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 76.00% 22.90% 0.67% 0.50% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 81.70% 16.10% 1.20% 0.99% NA
Indica Intermediate  786 89.10% 9.80% 0.51% 0.13% C: 0.51%
Temperate Japonica  767 49.20% 6.40% 3.52% 40.94% NA
Tropical Japonica  504 93.30% 0.40% 0.40% 5.95% NA
Japonica Intermediate  241 85.90% 0.80% 1.24% 12.03% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 0.00% C: 1.04%
Intermediate  90 87.80% 5.60% 0.00% 5.56% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207053263 G -> C LOC_Os12g12790.1 missense_variant ; p.Arg307Ser; MODERATE nonsynonymous_codon ; R307S Average:69.144; most accessible tissue: Minghui63 flag leaf, score: 82.053 unknown unknown DELETERIOUS 0.01
vg1207053263 G -> DEL LOC_Os12g12790.1 N frameshift_variant Average:69.144; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1207053263 G -> A LOC_Os12g12790.1 synonymous_variant ; p.Arg307Arg; LOW synonymous_codon Average:69.144; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207053263 NA 8.13E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207053263 NA 5.33E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 3.45E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 7.19E-06 4.76E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 4.18E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 8.51E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 7.85E-06 mr1306_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 5.69E-09 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 1.21E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 7.28E-06 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 5.61E-06 5.61E-06 mr1500_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 7.89E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 1.55E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 1.48E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 7.82E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 9.16E-09 mr1735_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 7.74E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 8.79E-06 8.79E-06 mr1787_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 1.10E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 7.71E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207053263 NA 8.75E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251