\
| Variant ID: vg1207043060 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7043060 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 318. )
TCTTGGCCAACTCTGAATACTTTTGGCTCCTTTTAATTTCTTCCGGGGAGTTCTTCAAGGTCAGAAAGTCGTCCCACTGATTGGGGGTTATGTTGGCATA[C/T]
GTCGAAAACGGTGTGCGTCCCGTCTTCACAAATTTCTTGTTCAAGGTGGTTTTCCAACCACGCTAAGACTTGGCCATTGTTTGCAGTGCACAATTTCTCA
TGAGAAATTGTGCACTGCAAACAATGGCCAAGTCTTAGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCGTTTTCGAC[G/A]
TATGCCAACATAACCCCCAATCAGTGGGACGACTTTCTGACCTTGAAGAACTCCCCGGAAGAAATTAAAAGGAGCCAAAAGTATTCAGAGTTGGCCAAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.00% | 12.70% | 5.88% | 18.43% | NA |
| All Indica | 2759 | 76.80% | 21.30% | 1.23% | 0.62% | NA |
| All Japonica | 1512 | 35.70% | 0.30% | 12.17% | 51.85% | NA |
| Aus | 269 | 72.10% | 0.00% | 12.64% | 15.24% | NA |
| Indica I | 595 | 44.20% | 54.60% | 0.17% | 1.01% | NA |
| Indica II | 465 | 83.40% | 14.00% | 1.72% | 0.86% | NA |
| Indica III | 913 | 96.30% | 3.00% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 75.10% | 21.80% | 2.67% | 0.51% | NA |
| Temperate Japonica | 767 | 39.50% | 0.50% | 6.78% | 53.19% | NA |
| Tropical Japonica | 504 | 20.00% | 0.00% | 22.42% | 57.54% | NA |
| Japonica Intermediate | 241 | 56.40% | 0.00% | 7.88% | 35.68% | NA |
| VI/Aromatic | 96 | 80.20% | 0.00% | 9.38% | 10.42% | NA |
| Intermediate | 90 | 50.00% | 10.00% | 18.89% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207043060 | C -> DEL | LOC_Os12g12770.1 | N | frameshift_variant | Average:32.237; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg1207043060 | C -> T | LOC_Os12g12770.1 | synonymous_variant ; p.Thr224Thr; LOW | synonymous_codon | Average:32.237; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207043060 | NA | 2.61E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207043060 | 2.40E-06 | 2.40E-06 | mr1899 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207043060 | 4.05E-07 | 4.03E-07 | mr1954 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207043060 | 4.53E-06 | 4.53E-06 | mr1954 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207043060 | NA | 9.14E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207043060 | NA | 1.02E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |