\
| Variant ID: vg1207040173 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7040173 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )
ATTTAAATTTAAATATAATTTGGCCGTAAATTACTTTTAAATTATTTATTAGAAATTCTTGCAGGTACATATATTGGAAGATTATCAAGCATTTGGTACT[G/A]
AGAAATCTACTTATATTGCATAAATCAAAAGTGTTGCCAAAATATATATATTACAATATTGTTTTACATTGTCACTTCAAATAACATCATCTAGTTACAT
ATGTAACTAGATGATGTTATTTGAAGTGACAATGTAAAACAATATTGTAATATATATATTTTGGCAACACTTTTGATTTATGCAATATAAGTAGATTTCT[C/T]
AGTACCAAATGCTTGATAATCTTCCAATATATGTACCTGCAAGAATTTCTAATAAATAATTTAAAAGTAATTTACGGCCAAATTATATTTAAATTTAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.70% | 23.90% | 2.48% | 22.94% | NA |
| All Indica | 2759 | 57.20% | 39.20% | 2.03% | 1.59% | NA |
| All Japonica | 1512 | 34.30% | 1.50% | 3.17% | 61.04% | NA |
| Aus | 269 | 71.40% | 0.70% | 1.86% | 26.02% | NA |
| Indica I | 595 | 88.40% | 7.20% | 3.19% | 1.18% | NA |
| Indica II | 465 | 28.80% | 66.90% | 2.37% | 1.94% | NA |
| Indica III | 913 | 48.00% | 50.80% | 0.55% | 0.66% | NA |
| Indica Intermediate | 786 | 60.90% | 33.60% | 2.67% | 2.80% | NA |
| Temperate Japonica | 767 | 38.10% | 0.80% | 2.74% | 58.41% | NA |
| Tropical Japonica | 504 | 17.90% | 3.00% | 4.76% | 74.40% | NA |
| Japonica Intermediate | 241 | 56.80% | 0.40% | 1.24% | 41.49% | NA |
| VI/Aromatic | 96 | 74.00% | 4.20% | 4.17% | 17.71% | NA |
| Intermediate | 90 | 42.20% | 20.00% | 4.44% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207040173 | G -> DEL | N | N | silent_mutation | Average:30.452; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1207040173 | G -> A | LOC_Os12g12770.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.452; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207040173 | NA | 1.73E-10 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1207040173 | NA | 7.95E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 6.34E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 5.00E-12 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 1.50E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 5.88E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 2.96E-08 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 4.35E-13 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 3.53E-10 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 3.36E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 2.50E-08 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 1.14E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 2.45E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 2.03E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 4.71E-07 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 2.22E-20 | mr1565_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 1.33E-16 | mr1565_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 9.29E-06 | mr1733_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207040173 | NA | 1.85E-09 | mr1861_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |