Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206974574:

Variant ID: vg1206974574 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 6974574
Reference Allele: T	Alternative Allele: A,TA,TCA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, T: 0.31, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

CACAGGGCATGGTATAGGCTGAGTTTGGTTGTTTACTTTCCCAACTCACCTATTTCGTTTTTAAAGTTGCTTTAAAAAAATCATATTAATCTATTTTTTT[T/A,TA,TCA]
AAAAAAAAGGTTGTTCCATTTTGCGTGCGTGGAGTGTGAGTTCCCAACGCAGGGAACCGAGCACAGCCATAATCTTTTACAAGCATGGTACATCATAATC

Reverse complement sequence

GATTATGATGTACCATGCTTGTAAAAGATTATGGCTGTGCTCGGTTCCCTGCGTTGGGAACTCACACTCCACGCACGCAAAATGGAACAACCTTTTTTTT[A/T,TA,TGA]
AAAAAAATAGATTAATATGATTTTTTTAAAGCAACTTTAAAAACGAAATAGGTGAGTTGGGAAAGTAAACAACCAAACTCAGCCTATACCATGCCCTGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	14.90%	3.15%	28.63%	TA: 0.06%; TCA: 0.02%
All Indica	2759	62.80%	24.70%	0.94%	11.49%	TCA: 0.04%; TA: 0.04%
All Japonica	1512	31.20%	0.80%	7.34%	60.65%	NA
Aus	269	71.00%	0.40%	2.97%	25.28%	TA: 0.37%
Indica I	595	20.30%	54.60%	1.85%	23.19%	NA
Indica II	465	80.40%	13.80%	0.43%	5.38%	NA
Indica III	913	82.40%	9.50%	0.33%	7.67%	TCA: 0.11%
Indica Intermediate	786	61.80%	26.10%	1.27%	10.69%	TA: 0.13%
Temperate Japonica	767	32.90%	1.60%	6.65%	58.93%	NA
Tropical Japonica	504	21.60%	0.00%	8.53%	69.84%	NA
Japonica Intermediate	241	46.10%	0.00%	7.05%	46.89%	NA
VI/Aromatic	96	78.10%	1.00%	2.08%	18.75%	NA
Intermediate	90	51.10%	8.90%	2.22%	36.67%	TA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206974574	T -> DEL	N	N	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> A	LOC_Os12g12664.1	downstream_gene_variant ; 2335.0bp to feature; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> A	LOC_Os12g12664.2	downstream_gene_variant ; 2335.0bp to feature; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> A	LOC_Os12g12650.1	intron_variant ; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> TCA	LOC_Os12g12664.1	downstream_gene_variant ; 2334.0bp to feature; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> TCA	LOC_Os12g12664.2	downstream_gene_variant ; 2334.0bp to feature; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> TCA	LOC_Os12g12650.1	intron_variant ; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> TA	LOC_Os12g12664.1	downstream_gene_variant ; 2334.0bp to feature; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> TA	LOC_Os12g12664.2	downstream_gene_variant ; 2334.0bp to feature; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N
vg1206974574	T -> TA	LOC_Os12g12650.1	intron_variant ; MODIFIER	silent_mutation	Average:66.198; most accessible tissue: Callus, score: 84.279	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206974574	NA	8.95E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206974574	6.39E-07	6.39E-07	mr1899	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206974574	8.08E-07	8.04E-07	mr1954	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206974574	3.79E-06	3.79E-06	mr1954	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206974574	NA	5.72E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251