\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206974574:

Variant ID: vg1206974574 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 6974574
Reference Allele: TAlternative Allele: A,TA,TCA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, T: 0.31, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


CACAGGGCATGGTATAGGCTGAGTTTGGTTGTTTACTTTCCCAACTCACCTATTTCGTTTTTAAAGTTGCTTTAAAAAAATCATATTAATCTATTTTTTT[T/A,TA,TCA]
AAAAAAAAGGTTGTTCCATTTTGCGTGCGTGGAGTGTGAGTTCCCAACGCAGGGAACCGAGCACAGCCATAATCTTTTACAAGCATGGTACATCATAATC

Reverse complement sequence

GATTATGATGTACCATGCTTGTAAAAGATTATGGCTGTGCTCGGTTCCCTGCGTTGGGAACTCACACTCCACGCACGCAAAATGGAACAACCTTTTTTTT[A/T,TA,TGA]
AAAAAAATAGATTAATATGATTTTTTTAAAGCAACTTTAAAAACGAAATAGGTGAGTTGGGAAAGTAAACAACCAAACTCAGCCTATACCATGCCCTGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 14.90% 3.15% 28.63% TA: 0.06%; TCA: 0.02%
All Indica  2759 62.80% 24.70% 0.94% 11.49% TCA: 0.04%; TA: 0.04%
All Japonica  1512 31.20% 0.80% 7.34% 60.65% NA
Aus  269 71.00% 0.40% 2.97% 25.28% TA: 0.37%
Indica I  595 20.30% 54.60% 1.85% 23.19% NA
Indica II  465 80.40% 13.80% 0.43% 5.38% NA
Indica III  913 82.40% 9.50% 0.33% 7.67% TCA: 0.11%
Indica Intermediate  786 61.80% 26.10% 1.27% 10.69% TA: 0.13%
Temperate Japonica  767 32.90% 1.60% 6.65% 58.93% NA
Tropical Japonica  504 21.60% 0.00% 8.53% 69.84% NA
Japonica Intermediate  241 46.10% 0.00% 7.05% 46.89% NA
VI/Aromatic  96 78.10% 1.00% 2.08% 18.75% NA
Intermediate  90 51.10% 8.90% 2.22% 36.67% TA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206974574 T -> DEL N N silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> A LOC_Os12g12664.1 downstream_gene_variant ; 2335.0bp to feature; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> A LOC_Os12g12664.2 downstream_gene_variant ; 2335.0bp to feature; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> A LOC_Os12g12650.1 intron_variant ; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> TCA LOC_Os12g12664.1 downstream_gene_variant ; 2334.0bp to feature; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> TCA LOC_Os12g12664.2 downstream_gene_variant ; 2334.0bp to feature; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> TCA LOC_Os12g12650.1 intron_variant ; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> TA LOC_Os12g12664.1 downstream_gene_variant ; 2334.0bp to feature; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> TA LOC_Os12g12664.2 downstream_gene_variant ; 2334.0bp to feature; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N
vg1206974574 T -> TA LOC_Os12g12650.1 intron_variant ; MODIFIER silent_mutation Average:66.198; most accessible tissue: Callus, score: 84.279 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206974574 NA 8.95E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206974574 6.39E-07 6.39E-07 mr1899 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206974574 8.08E-07 8.04E-07 mr1954 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206974574 3.79E-06 3.79E-06 mr1954 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206974574 NA 5.72E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251