\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206971120:

Variant ID: vg1206971120 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6971120
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAAATCCGAGTTCAAAATCAAAACTTGATCAAACATCAGGATGACAAGAAGATCAAATACATAGTTTAAAAAGGGGATGTAGCAGCTTGTTCGAGGCC[G/A]
TCACAAAACATAGGAAAATCTGAGCGGCATGGAGAACTGCAATCGCGGCCGCCAACCTTCAATGCAAAGATCGGCACTTTATCCGGCCCCTTTGCTCTGC

Reverse complement sequence

GCAGAGCAAAGGGGCCGGATAAAGTGCCGATCTTTGCATTGAAGGTTGGCGGCCGCGATTGCAGTTCTCCATGCCGCTCAGATTTTCCTATGTTTTGTGA[C/T]
GGCCTCGAACAAGCTGCTACATCCCCTTTTTAAACTATGTATTTGATCTTCTTGTCATCCTGATGTTTGATCAAGTTTTGATTTTGAACTCGGATTTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.40% 5.40% 1.74% 23.53% NA
All Indica  2759 87.90% 7.80% 0.91% 3.37% NA
All Japonica  1512 33.80% 2.20% 3.37% 60.58% NA
Aus  269 76.60% 0.00% 0.74% 22.68% NA
Indica I  595 75.80% 19.00% 3.19% 2.02% NA
Indica II  465 94.60% 3.20% 0.00% 2.15% NA
Indica III  913 91.30% 5.10% 0.00% 3.50% NA
Indica Intermediate  786 89.10% 5.20% 0.76% 4.96% NA
Temperate Japonica  767 37.40% 4.00% 2.87% 55.67% NA
Tropical Japonica  504 22.40% 0.40% 4.37% 72.82% NA
Japonica Intermediate  241 46.10% 0.40% 2.90% 50.62% NA
VI/Aromatic  96 79.20% 0.00% 2.08% 18.75% NA
Intermediate  90 67.80% 3.30% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206971120 G -> DEL N N silent_mutation Average:30.014; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg1206971120 G -> A LOC_Os12g12640.1 upstream_gene_variant ; 3900.0bp to feature; MODIFIER silent_mutation Average:30.014; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg1206971120 G -> A LOC_Os12g12650.1 upstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:30.014; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg1206971120 G -> A LOC_Os12g12640-LOC_Os12g12650 intergenic_region ; MODIFIER silent_mutation Average:30.014; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206971120 NA 1.66E-08 mr1585 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206971120 NA 2.81E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206971120 NA 7.45E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251