Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206971120:

Variant ID: vg1206971120 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6971120
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAAATCCGAGTTCAAAATCAAAACTTGATCAAACATCAGGATGACAAGAAGATCAAATACATAGTTTAAAAAGGGGATGTAGCAGCTTGTTCGAGGCC[G/A]
TCACAAAACATAGGAAAATCTGAGCGGCATGGAGAACTGCAATCGCGGCCGCCAACCTTCAATGCAAAGATCGGCACTTTATCCGGCCCCTTTGCTCTGC

Reverse complement sequence

GCAGAGCAAAGGGGCCGGATAAAGTGCCGATCTTTGCATTGAAGGTTGGCGGCCGCGATTGCAGTTCTCCATGCCGCTCAGATTTTCCTATGTTTTGTGA[C/T]
GGCCTCGAACAAGCTGCTACATCCCCTTTTTAAACTATGTATTTGATCTTCTTGTCATCCTGATGTTTGATCAAGTTTTGATTTTGAACTCGGATTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.40%	5.40%	1.74%	23.53%	NA
All Indica	2759	87.90%	7.80%	0.91%	3.37%	NA
All Japonica	1512	33.80%	2.20%	3.37%	60.58%	NA
Aus	269	76.60%	0.00%	0.74%	22.68%	NA
Indica I	595	75.80%	19.00%	3.19%	2.02%	NA
Indica II	465	94.60%	3.20%	0.00%	2.15%	NA
Indica III	913	91.30%	5.10%	0.00%	3.50%	NA
Indica Intermediate	786	89.10%	5.20%	0.76%	4.96%	NA
Temperate Japonica	767	37.40%	4.00%	2.87%	55.67%	NA
Tropical Japonica	504	22.40%	0.40%	4.37%	72.82%	NA
Japonica Intermediate	241	46.10%	0.40%	2.90%	50.62%	NA
VI/Aromatic	96	79.20%	0.00%	2.08%	18.75%	NA
Intermediate	90	67.80%	3.30%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206971120	G -> DEL	N	N	silent_mutation	Average:30.014; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1206971120	G -> A	LOC_Os12g12640.1	upstream_gene_variant ; 3900.0bp to feature; MODIFIER	silent_mutation	Average:30.014; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1206971120	G -> A	LOC_Os12g12650.1	upstream_gene_variant ; 537.0bp to feature; MODIFIER	silent_mutation	Average:30.014; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1206971120	G -> A	LOC_Os12g12640-LOC_Os12g12650	intergenic_region ; MODIFIER	silent_mutation	Average:30.014; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206971120	NA	1.66E-08	mr1585	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206971120	NA	2.81E-06	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206971120	NA	7.45E-07	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251