Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206960675:

Variant ID: vg1206960675 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6960675
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTAGTCACAAGTGATATACTGGCAAGATGGTCAGCGAGATGTAACCTCAACCCACAGACCTGAGGTCGATTCCCAAGTACGCACCCATTTTTGCCAAA[A/C]
AATTCGATGATATGGACCATACTGGGCCTCTCATTGGCCCATTACAAACCTTCACTGGTCCAACCATAGGCGGTTTAATCTCCGGTTCAATACAGAACCG

Reverse complement sequence

CGGTTCTGTATTGAACCGGAGATTAAACCGCCTATGGTTGGACCAGTGAAGGTTTGTAATGGGCCAATGAGAGGCCCAGTATGGTCCATATCATCGAATT[T/G]
TTTGGCAAAAATGGGTGCGTACTTGGGAATCGACCTCAGGTCTGTGGGTTGAGGTTACATCTCGCTGACCATCTTGCCAGTATATCACTTGTGACTACTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 28.20% 0.00% 0.00% NA
All Indica  2759 62.00% 38.00% 0.00% 0.00% NA
All Japonica  1512 96.70% 3.30% 0.00% 0.00% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 17.60% 82.40% 0.00% 0.00% NA
Indica II  465 79.40% 20.60% 0.00% 0.00% NA
Indica III  913 84.90% 15.10% 0.00% 0.00% NA
Indica Intermediate  786 58.70% 41.30% 0.00% 0.00% NA
Temperate Japonica  767 95.00% 5.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206960675 A -> C LOC_Os12g12620.1 upstream_gene_variant ; 3117.0bp to feature; MODIFIER silent_mutation Average:88.352; most accessible tissue: Callus, score: 97.624 N N N N
vg1206960675 A -> C LOC_Os12g12630.1 upstream_gene_variant ; 1502.0bp to feature; MODIFIER silent_mutation Average:88.352; most accessible tissue: Callus, score: 97.624 N N N N
vg1206960675 A -> C LOC_Os12g12640.1 downstream_gene_variant ; 4941.0bp to feature; MODIFIER silent_mutation Average:88.352; most accessible tissue: Callus, score: 97.624 N N N N
vg1206960675 A -> C LOC_Os12g12630-LOC_Os12g12640 intergenic_region ; MODIFIER silent_mutation Average:88.352; most accessible tissue: Callus, score: 97.624 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1206960675 A C 0.02 0.02 0.02 0.03 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206960675 NA 9.63E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206960675 NA 1.59E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206960675 NA 9.59E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206960675 NA 7.81E-07 mr1680 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206960675 NA 3.08E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251