\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206941863:

Variant ID: vg1206941863 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6941863
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGCATAACAAACTCATAAATATAATAGTCTAATCTAACAAATTTCTACACTCCAACAATGTACTCCATAAATTTATTATGTTTCTTCGTAGCAAAGGG[C/A]
AAAATGGACTTTTTCATAAGAATTTAACGGTCCACTGACGGTCAACTAGGGAAAAGGGCGTGCAACCGTGCAAGGGATCCAGACTAAAATTCAGGTGTAT

Reverse complement sequence

ATACACCTGAATTTTAGTCTGGATCCCTTGCACGGTTGCACGCCCTTTTCCCTAGTTGACCGTCAGTGGACCGTTAAATTCTTATGAAAAAGTCCATTTT[G/T]
CCCTTTGCTACGAAGAAACATAATAAATTTATGGAGTACATTGTTGGAGTGTAGAAATTTGTTAGATTAGACTATTATATTTATGAGTTTGTTATGCACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.70% 17.80% 0.04% 0.53% NA
All Indica  2759 70.90% 28.70% 0.07% 0.40% NA
All Japonica  1512 97.30% 2.60% 0.00% 0.07% NA
Aus  269 96.30% 0.00% 0.00% 3.72% NA
Indica I  595 20.80% 79.00% 0.17% 0.00% NA
Indica II  465 82.80% 17.00% 0.00% 0.22% NA
Indica III  913 96.90% 2.30% 0.00% 0.77% NA
Indica Intermediate  786 71.40% 28.10% 0.13% 0.38% NA
Temperate Japonica  767 95.00% 5.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206941863 C -> DEL N N silent_mutation Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N
vg1206941863 C -> A LOC_Os12g12600.1 upstream_gene_variant ; 3343.0bp to feature; MODIFIER silent_mutation Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N
vg1206941863 C -> A LOC_Os12g12590.1 downstream_gene_variant ; 4792.0bp to feature; MODIFIER silent_mutation Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N
vg1206941863 C -> A LOC_Os12g12590-LOC_Os12g12600 intergenic_region ; MODIFIER silent_mutation Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206941863 NA 7.10E-08 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863 NA 2.17E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863 NA 8.48E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863 NA 1.26E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863 NA 4.01E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863 NA 1.68E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863 5.80E-07 8.16E-08 mr1673 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863 NA 9.24E-06 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251