| Variant ID: vg1206941863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6941863 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 103. )
GGTGCATAACAAACTCATAAATATAATAGTCTAATCTAACAAATTTCTACACTCCAACAATGTACTCCATAAATTTATTATGTTTCTTCGTAGCAAAGGG[C/A]
AAAATGGACTTTTTCATAAGAATTTAACGGTCCACTGACGGTCAACTAGGGAAAAGGGCGTGCAACCGTGCAAGGGATCCAGACTAAAATTCAGGTGTAT
ATACACCTGAATTTTAGTCTGGATCCCTTGCACGGTTGCACGCCCTTTTCCCTAGTTGACCGTCAGTGGACCGTTAAATTCTTATGAAAAAGTCCATTTT[G/T]
CCCTTTGCTACGAAGAAACATAATAAATTTATGGAGTACATTGTTGGAGTGTAGAAATTTGTTAGATTAGACTATTATATTTATGAGTTTGTTATGCACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.70% | 17.80% | 0.04% | 0.53% | NA |
| All Indica | 2759 | 70.90% | 28.70% | 0.07% | 0.40% | NA |
| All Japonica | 1512 | 97.30% | 2.60% | 0.00% | 0.07% | NA |
| Aus | 269 | 96.30% | 0.00% | 0.00% | 3.72% | NA |
| Indica I | 595 | 20.80% | 79.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 82.80% | 17.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 96.90% | 2.30% | 0.00% | 0.77% | NA |
| Indica Intermediate | 786 | 71.40% | 28.10% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206941863 | C -> DEL | N | N | silent_mutation | Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553 | N | N | N | N |
| vg1206941863 | C -> A | LOC_Os12g12600.1 | upstream_gene_variant ; 3343.0bp to feature; MODIFIER | silent_mutation | Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553 | N | N | N | N |
| vg1206941863 | C -> A | LOC_Os12g12590.1 | downstream_gene_variant ; 4792.0bp to feature; MODIFIER | silent_mutation | Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553 | N | N | N | N |
| vg1206941863 | C -> A | LOC_Os12g12590-LOC_Os12g12600 | intergenic_region ; MODIFIER | silent_mutation | Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206941863 | NA | 7.10E-08 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206941863 | NA | 2.17E-06 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206941863 | NA | 8.48E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206941863 | NA | 1.26E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206941863 | NA | 4.01E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206941863 | NA | 1.68E-06 | mr1549 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206941863 | 5.80E-07 | 8.16E-08 | mr1673 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206941863 | NA | 9.24E-06 | mr1680 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |