\
| Variant ID: vg1206809257 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6809257 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 232. )
TCATGTGAGATAAGTAGCATTAAATTTAAGTATAGAATAGTGGTGTTTGCATTGGAATAGTAGTGTCTAGTACTAGTTTCTTGATGATGTGAAGTTTATG[G/A,T]
AAACTATGTCTAGTGTCTAGGGTTGGGAATAGCCTTAATCGATACATGTATTGTGGGAGAATGCATGTGTGCATAGTGTCTTGATTGATGTGATTTAAAT
ATTTAAATCACATCAATCAAGACACTATGCACACATGCATTCTCCCACAATACATGTATCGATTAAGGCTATTCCCAACCCTAGACACTAGACATAGTTT[C/T,A]
CATAAACTTCACATCATCAAGAAACTAGTACTAGACACTACTATTCCAATGCAAACACCACTATTCTATACTTAAATTTAATGCTACTTATCTCACATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 46.40% | 0.04% | 0.00% | T: 0.02% |
| All Indica | 2759 | 85.70% | 14.20% | 0.07% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 6.40% | 93.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.00% | 17.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 78.60% | 21.10% | 0.13% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 9.80% | 90.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 71.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206809257 | G -> A | LOC_Os12g12360.1 | upstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1206809257 | G -> A | LOC_Os12g12370.1 | upstream_gene_variant ; 1961.0bp to feature; MODIFIER | silent_mutation | Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1206809257 | G -> A | LOC_Os12g12360.2 | upstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1206809257 | G -> A | LOC_Os12g12360-LOC_Os12g12370 | intergenic_region ; MODIFIER | silent_mutation | Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1206809257 | G -> T | LOC_Os12g12360.1 | upstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1206809257 | G -> T | LOC_Os12g12370.1 | upstream_gene_variant ; 1961.0bp to feature; MODIFIER | silent_mutation | Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1206809257 | G -> T | LOC_Os12g12360.2 | upstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1206809257 | G -> T | LOC_Os12g12360-LOC_Os12g12370 | intergenic_region ; MODIFIER | silent_mutation | Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206809257 | 8.61E-09 | 2.37E-30 | mr1024 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206809257 | NA | 8.41E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206809257 | NA | 8.42E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206809257 | NA | 5.66E-13 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |