Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1206809257:

Variant ID: vg1206809257 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6809257
Reference Allele: G	Alternative Allele: A,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TCATGTGAGATAAGTAGCATTAAATTTAAGTATAGAATAGTGGTGTTTGCATTGGAATAGTAGTGTCTAGTACTAGTTTCTTGATGATGTGAAGTTTATG[G/A,T]
AAACTATGTCTAGTGTCTAGGGTTGGGAATAGCCTTAATCGATACATGTATTGTGGGAGAATGCATGTGTGCATAGTGTCTTGATTGATGTGATTTAAAT

Reverse complement sequence

ATTTAAATCACATCAATCAAGACACTATGCACACATGCATTCTCCCACAATACATGTATCGATTAAGGCTATTCCCAACCCTAGACACTAGACATAGTTT[C/T,A]
CATAAACTTCACATCATCAAGAAACTAGTACTAGACACTACTATTCCAATGCAAACACCACTATTCTATACTTAAATTTAATGCTACTTATCTCACATGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.50%	46.40%	0.04%	0.00%	T: 0.02%
All Indica	2759	85.70%	14.20%	0.07%	0.00%	T: 0.04%
All Japonica	1512	6.40%	93.60%	0.00%	0.00%	NA
Aus	269	14.90%	85.10%	0.00%	0.00%	NA
Indica I	595	95.30%	4.70%	0.00%	0.00%	NA
Indica II	465	92.50%	7.50%	0.00%	0.00%	NA
Indica III	913	82.00%	17.90%	0.11%	0.00%	NA
Indica Intermediate	786	78.60%	21.10%	0.13%	0.00%	T: 0.13%
Temperate Japonica	767	9.80%	90.20%	0.00%	0.00%	NA
Tropical Japonica	504	3.80%	96.20%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	28.90%	71.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206809257	G -> A	LOC_Os12g12360.1	upstream_gene_variant ; 2280.0bp to feature; MODIFIER	silent_mutation	Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1206809257	G -> A	LOC_Os12g12370.1	upstream_gene_variant ; 1961.0bp to feature; MODIFIER	silent_mutation	Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1206809257	G -> A	LOC_Os12g12360.2	upstream_gene_variant ; 2280.0bp to feature; MODIFIER	silent_mutation	Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1206809257	G -> A	LOC_Os12g12360-LOC_Os12g12370	intergenic_region ; MODIFIER	silent_mutation	Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1206809257	G -> T	LOC_Os12g12360.1	upstream_gene_variant ; 2280.0bp to feature; MODIFIER	silent_mutation	Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1206809257	G -> T	LOC_Os12g12370.1	upstream_gene_variant ; 1961.0bp to feature; MODIFIER	silent_mutation	Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1206809257	G -> T	LOC_Os12g12360.2	upstream_gene_variant ; 2280.0bp to feature; MODIFIER	silent_mutation	Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1206809257	G -> T	LOC_Os12g12360-LOC_Os12g12370	intergenic_region ; MODIFIER	silent_mutation	Average:52.854; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206809257	8.61E-09	2.37E-30	mr1024	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206809257	NA	8.41E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206809257	NA	8.42E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206809257	NA	5.66E-13	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251