\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206782775:

Variant ID: vg1206782775 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6782775
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TATCCTCGTGGTTATAGAGTTCCCGAATTTACCAAATTTAGTGGTGAGGATAGTAGGACCACATGGGAGCATGTAGGTCAGTTCTTAGCGCAAATGTGGT[G/A]
AGGCTAGTAGTTCTCATACTTTTAAATTGCGCTTGTTTTCTTTATCTTTGTCCGGTACTGCTTTTATATGGTTTACTTCTTTACCAGCAAATTCCATTCA

Reverse complement sequence

TGAATGGAATTTGCTGGTAAAGAAGTAAACCATATAAAAGCAGTACCGGACAAAGATAAAGAAAACAAGCGCAATTTAAAAGTATGAGAACTACTAGCCT[C/T]
ACCACATTTGCGCTAAGAACTGACCTACATGCTCCCATGTGGTCCTACTATCCTCACCACTAAATTTGGTAAATTCGGGAACTCTATAACCACGAGGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 37.20% 0.23% 0.00% NA
All Indica  2759 38.70% 60.90% 0.36% 0.00% NA
All Japonica  1512 96.40% 3.60% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 74.10% 25.90% 0.00% 0.00% NA
Indica II  465 9.00% 91.00% 0.00% 0.00% NA
Indica III  913 23.90% 75.80% 0.33% 0.00% NA
Indica Intermediate  786 46.70% 52.40% 0.89% 0.00% NA
Temperate Japonica  767 95.00% 5.00% 0.00% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206782775 G -> A LOC_Os12g12330.1 downstream_gene_variant ; 3084.0bp to feature; MODIFIER silent_mutation Average:39.312; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1206782775 G -> A LOC_Os12g12340.1 intron_variant ; MODIFIER silent_mutation Average:39.312; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206782775 NA 9.89E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1206782775 NA 1.86E-09 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 4.13E-08 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 2.57E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 9.74E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 3.98E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 5.90E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 1.88E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 1.15E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 8.28E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 1.18E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 1.18E-07 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 2.32E-09 mr1508_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 7.88E-07 mr1508_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 3.83E-12 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 3.52E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 8.54E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 1.85E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 5.80E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 5.55E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 4.41E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206782775 NA 9.42E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251