\
| Variant ID: vg1206771466 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6771466 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 200. )
TATGTTGACATTGATAATCATCACATTTTAAACTCTTTTGACATCATAGTGTAAGTTAGAGCTGATGTTATTTCATTTCCCGTTGCAACGCACGGGCACC[C/T]
AACCAGTTTCCAAAATAAGCATATATACTTTACTTGCAAATGGTAATATTTTTCAACAATATAGATTCATACGAGAGAGCATATTGAAAACTCTGTCACT
AGTGACAGAGTTTTCAATATGCTCTCTCGTATGAATCTATATTGTTGAAAAATATTACCATTTGCAAGTAAAGTATATATGCTTATTTTGGAAACTGGTT[G/A]
GGTGCCCGTGCGTTGCAACGGGAAATGAAATAACATCAGCTCTAACTTACACTATGATGTCAAAAGAGTTTAAAATGTGATGATTATCAATGTCAACATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.30% | 25.50% | 0.19% | 0.06% | NA |
| All Indica | 2759 | 65.40% | 34.10% | 0.33% | 0.11% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 42.80% | 57.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 28.20% | 71.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 94.40% | 5.20% | 0.22% | 0.22% | NA |
| Indica III | 913 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 58.70% | 40.50% | 0.64% | 0.25% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206771466 | C -> DEL | N | N | silent_mutation | Average:52.807; most accessible tissue: Callus, score: 75.001 | N | N | N | N |
| vg1206771466 | C -> T | LOC_Os12g12310.1 | downstream_gene_variant ; 527.0bp to feature; MODIFIER | silent_mutation | Average:52.807; most accessible tissue: Callus, score: 75.001 | N | N | N | N |
| vg1206771466 | C -> T | LOC_Os12g12300-LOC_Os12g12310 | intergenic_region ; MODIFIER | silent_mutation | Average:52.807; most accessible tissue: Callus, score: 75.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206771466 | NA | 1.99E-10 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1206771466 | NA | 4.57E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206771466 | NA | 1.08E-06 | mr1659 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206771466 | NA | 6.95E-06 | mr1942 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206771466 | NA | 1.14E-06 | mr1497_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206771466 | NA | 1.66E-08 | mr1508_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206771466 | NA | 2.02E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |