\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206753482:

Variant ID: vg1206753482 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6753482
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.03, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAATACTCAAATCTATTTTCCTTTTGACTCCAAGTCATTGATTGAGTTGGATTTATTACTAAGTCTCCCCAGCACATGCATGCCATTTGTTTGGCACT[G/T]
TTACACACACCTTTCTTGTCACACACCCTAGGAACTAGTTTTGCCCAAAACATTGGATCAATAATTATCACTACTCTCTTTTTTCTTCTTCTAATAGACG

Reverse complement sequence

CGTCTATTAGAAGAAGAAAAAAGAGAGTAGTGATAATTATTGATCCAATGTTTTGGGCAAAACTAGTTCCTAGGGTGTGTGACAAGAAAGGTGTGTGTAA[C/A]
AGTGCCAAACAAATGGCATGCATGTGCTGGGGAGACTTAGTAATAAATCCAACTCAATCAATGACTTGGAGTCAAAAGGAAAATAGATTTGAGTATTCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 35.00% 0.17% 0.00% NA
All Indica  2759 96.80% 3.10% 0.11% 0.00% NA
All Japonica  1512 6.90% 93.00% 0.13% 0.00% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.20% 0.38% 0.00% NA
Temperate Japonica  767 10.00% 90.00% 0.00% 0.00% NA
Tropical Japonica  504 3.80% 95.80% 0.40% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 51.10% 45.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206753482 G -> T LOC_Os12g12290.1 downstream_gene_variant ; 1479.0bp to feature; MODIFIER silent_mutation Average:63.18; most accessible tissue: Callus, score: 91.604 N N N N
vg1206753482 G -> T LOC_Os12g12280-LOC_Os12g12290 intergenic_region ; MODIFIER silent_mutation Average:63.18; most accessible tissue: Callus, score: 91.604 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206753482 NA 6.55E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 2.22E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 1.43E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 5.15E-51 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 3.36E-06 1.29E-06 mr1110_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 2.19E-36 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 1.16E-23 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 3.95E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 4.11E-37 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 8.94E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 1.65E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 3.72E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 2.73E-18 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 2.58E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 5.20E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 1.38E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206753482 NA 3.30E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251