\
| Variant ID: vg1206688034 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6688034 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, A: 0.39, others allele: 0.00, population size: 88. )
TTGTGCAGTACTAAGCAGGTAATCTTGGCTTTGTGATATGCATGGTTTGTGTCTGAACCTTCAGGGTAATTGCATTTTTCCTTTGTAACATGAGACAATC[T/A]
GAGTTCTGAAGGATTCCAATTAGAAGATTTATGACCTGTTCGATGCTTTCGTTGCTGATTTGCTTCTGCATACCTCCAAAACCTGATTATTTAATCAATG
CATTGATTAAATAATCAGGTTTTGGAGGTATGCAGAAGCAAATCAGCAACGAAAGCATCGAACAGGTCATAAATCTTCTAATTGGAATCCTTCAGAACTC[A/T]
GATTGTCTCATGTTACAAAGGAAAAATGCAATTACCCTGAAGGTTCAGACACAAACCATGCATATCACAAAGCCAAGATTACCTGCTTAGTACTGCACAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 43.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 87.80% | 12.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 27.90% | 72.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.60% | 8.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.20% | 11.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 84.00% | 15.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 5.10% | 94.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206688034 | T -> A | LOC_Os12g12180.1 | downstream_gene_variant ; 168.0bp to feature; MODIFIER | silent_mutation | Average:67.192; most accessible tissue: Callus, score: 84.999 | N | N | N | N |
| vg1206688034 | T -> A | LOC_Os12g12190.1 | downstream_gene_variant ; 1572.0bp to feature; MODIFIER | silent_mutation | Average:67.192; most accessible tissue: Callus, score: 84.999 | N | N | N | N |
| vg1206688034 | T -> A | LOC_Os12g12180-LOC_Os12g12190 | intergenic_region ; MODIFIER | silent_mutation | Average:67.192; most accessible tissue: Callus, score: 84.999 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206688034 | NA | 7.35E-18 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 3.19E-14 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 9.08E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 1.19E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 4.51E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 3.13E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 6.04E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 2.65E-22 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 7.68E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 2.52E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 4.59E-19 | mr1578_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206688034 | NA | 1.51E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |