\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206688034:

Variant ID: vg1206688034 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6688034
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, A: 0.39, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGCAGTACTAAGCAGGTAATCTTGGCTTTGTGATATGCATGGTTTGTGTCTGAACCTTCAGGGTAATTGCATTTTTCCTTTGTAACATGAGACAATC[T/A]
GAGTTCTGAAGGATTCCAATTAGAAGATTTATGACCTGTTCGATGCTTTCGTTGCTGATTTGCTTCTGCATACCTCCAAAACCTGATTATTTAATCAATG

Reverse complement sequence

CATTGATTAAATAATCAGGTTTTGGAGGTATGCAGAAGCAAATCAGCAACGAAAGCATCGAACAGGTCATAAATCTTCTAATTGGAATCCTTCAGAACTC[A/T]
GATTGTCTCATGTTACAAAGGAAAAATGCAATTACCCTGAAGGTTCAGACACAAACCATGCATATCACAAAGCCAAGATTACCTGCTTAGTACTGCACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.30% 0.08% 0.00% NA
All Indica  2759 87.80% 12.00% 0.14% 0.00% NA
All Japonica  1512 3.80% 96.20% 0.00% 0.00% NA
Aus  269 27.90% 72.10% 0.00% 0.00% NA
Indica I  595 91.60% 8.10% 0.34% 0.00% NA
Indica II  465 88.80% 11.20% 0.00% 0.00% NA
Indica III  913 88.20% 11.70% 0.11% 0.00% NA
Indica Intermediate  786 84.00% 15.90% 0.13% 0.00% NA
Temperate Japonica  767 5.10% 94.90% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206688034 T -> A LOC_Os12g12180.1 downstream_gene_variant ; 168.0bp to feature; MODIFIER silent_mutation Average:67.192; most accessible tissue: Callus, score: 84.999 N N N N
vg1206688034 T -> A LOC_Os12g12190.1 downstream_gene_variant ; 1572.0bp to feature; MODIFIER silent_mutation Average:67.192; most accessible tissue: Callus, score: 84.999 N N N N
vg1206688034 T -> A LOC_Os12g12180-LOC_Os12g12190 intergenic_region ; MODIFIER silent_mutation Average:67.192; most accessible tissue: Callus, score: 84.999 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206688034 NA 7.35E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 3.19E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 9.08E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 1.19E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 4.51E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 3.13E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 6.04E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 2.65E-22 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 7.68E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 2.52E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 4.59E-19 mr1578_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206688034 NA 1.51E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251