\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206605318:

Variant ID: vg1206605318 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6605318
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCCAATGTTACTATATGGTTATCCTTTTATGTATTATATGCCATGGATGCCTCAACCACCTATGCCGTGTCATCAAGCATGGAAGCAATCACCTAGGA[C/T]
GGTACCAAGTCATTCTAACTCAAGACAAGACCGTTTCCCACGAAAGAATCGGTCAAGTGGATCAAAAGTGAAAAATGTGAAGAAGTTGTGGGTGAGAAAA

Reverse complement sequence

TTTTCTCACCCACAACTTCTTCACATTTTTCACTTTTGATCCACTTGACCGATTCTTTCGTGGGAAACGGTCTTGTCTTGAGTTAGAATGACTTGGTACC[G/A]
TCCTAGGTGATTGCTTCCATGCTTGATGACACGGCATAGGTGGTTGAGGCATCCATGGCATATAATACATAAAAGGATAACCATATAGTAACATTGGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.90% 0.80% 2.73% 2.52% NA
All Indica  2759 92.00% 1.10% 3.70% 3.26% NA
All Japonica  1512 98.10% 0.10% 0.33% 1.52% NA
Aus  269 92.20% 1.90% 5.95% 0.00% NA
Indica I  595 90.10% 0.70% 4.54% 4.71% NA
Indica II  465 98.10% 0.40% 0.86% 0.65% NA
Indica III  913 89.60% 1.60% 4.82% 3.94% NA
Indica Intermediate  786 92.60% 1.00% 3.44% 2.93% NA
Temperate Japonica  767 96.70% 0.00% 0.39% 2.87% NA
Tropical Japonica  504 99.20% 0.20% 0.40% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 5.20% 4.17% 2.08% NA
Intermediate  90 93.30% 0.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206605318 C -> DEL N N silent_mutation Average:8.028; most accessible tissue: Callus, score: 15.168 N N N N
vg1206605318 C -> T LOC_Os12g12060.1 downstream_gene_variant ; 3247.0bp to feature; MODIFIER silent_mutation Average:8.028; most accessible tissue: Callus, score: 15.168 N N N N
vg1206605318 C -> T LOC_Os12g12040-LOC_Os12g12060 intergenic_region ; MODIFIER silent_mutation Average:8.028; most accessible tissue: Callus, score: 15.168 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206605318 7.43E-06 7.44E-06 mr1187 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206605318 1.49E-06 4.59E-06 mr1245 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206605318 NA 3.83E-06 mr1319 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206605318 1.74E-06 1.74E-06 mr1323 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206605318 NA 1.02E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251